Incidental Mutation 'R7024:Snx15'
ID545874
Institutional Source Beutler Lab
Gene Symbol Snx15
Ensembl Gene ENSMUSG00000024787
Gene Namesorting nexin 15
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7024 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location6119399-6128304 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 6120596 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 271 (Q271L)
Ref Sequence ENSEMBL: ENSMUSP00000025702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025702] [ENSMUST00000044451] [ENSMUST00000113533] [ENSMUST00000138931] [ENSMUST00000154601]
Predicted Effect probably damaging
Transcript: ENSMUST00000025702
AA Change: Q271L

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025702
Gene: ENSMUSG00000024787
AA Change: Q271L

DomainStartEndE-ValueType
PX 8 126 1.78e-22 SMART
low complexity region 140 151 N/A INTRINSIC
MIT 265 337 7.77e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000044451
SMART Domains Protein: ENSMUSP00000044231
Gene: ENSMUSG00000054999

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 32 47 N/A INTRINSIC
Pfam:PA 163 256 3e-12 PFAM
Pfam:Peptidase_M28 353 564 1.3e-22 PFAM
low complexity region 579 592 N/A INTRINSIC
Pfam:TFR_dimer 621 740 4.5e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113533
SMART Domains Protein: ENSMUSP00000109161
Gene: ENSMUSG00000024790

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
Pfam:SAC3_GANP 134 356 7.6e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138931
SMART Domains Protein: ENSMUSP00000114189
Gene: ENSMUSG00000024787

DomainStartEndE-ValueType
PX 8 112 1.69e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154601
SMART Domains Protein: ENSMUSP00000122740
Gene: ENSMUSG00000024787

DomainStartEndE-ValueType
PX 8 126 1.78e-22 SMART
low complexity region 140 151 N/A INTRINSIC
Blast:MIT 222 251 4e-12 BLAST
Meta Mutation Damage Score 0.1185 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 97% (61/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. Overexpression of this gene results in a decrease in the processing of insulin and hepatocyte growth factor receptors to their mature subunits. This decrease is caused by the mislocalization of furin, the endoprotease responsible for cleavage of insulin and hepatocyte growth factor receptors. This protein is involved in endosomal trafficking from the plasma membrane to recycling endosomes or the trans-Golgi network. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the upstream ADP-ribosylation factor-like 2 (ARL2) gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik A G 16: 88,627,220 S128P probably damaging Het
Abcc1 G C 16: 14,413,383 probably null Het
Armc4 A C 18: 7,211,593 D760E probably benign Het
Atg2a G A 19: 6,250,219 G686S possibly damaging Het
Atrnl1 A T 19: 57,638,450 probably null Het
Brd4 T C 17: 32,221,910 probably benign Het
C77080 T A 4: 129,225,408 E173V probably null Het
Camsap3 A G 8: 3,608,242 E688G probably damaging Het
Cc2d2a T A 5: 43,733,929 S1402R probably benign Het
Ccnb1 A G 13: 100,786,380 probably null Het
Cdc42bpb G A 12: 111,326,085 H339Y probably damaging Het
Ciart T A 3: 95,879,080 T94S probably benign Het
Col6a5 T A 9: 105,912,475 K1540* probably null Het
Csmd3 A T 15: 47,710,991 V1969E probably damaging Het
Dgka T G 10: 128,720,487 N710T probably damaging Het
Dock6 A G 9: 21,820,370 V1212A probably benign Het
En1 C T 1: 120,603,322 P97L unknown Het
Esd T A 14: 74,744,662 F172L probably damaging Het
Gfer C A 17: 24,695,968 D34Y probably damaging Het
Gm2832 G A 14: 41,279,739 M68I Het
Hmgcr A G 13: 96,658,910 S384P probably benign Het
Hsp90aa1 T C 12: 110,694,112 T299A possibly damaging Het
Igsf10 A G 3: 59,331,701 M353T probably benign Het
Ino80b T C 6: 83,122,325 T211A probably benign Het
Lamb2 C A 9: 108,489,488 T1607K probably benign Het
Lhfpl5 A G 17: 28,582,983 E218G probably benign Het
Lpo C A 11: 87,816,443 C248F probably damaging Het
Lrrc3 C T 10: 77,900,991 D204N probably damaging Het
Mavs C A 2: 131,243,131 L160I probably benign Het
Morn4 C T 19: 42,078,044 D35N possibly damaging Het
Mroh8 G A 2: 157,221,263 H813Y probably benign Het
Myf6 T C 10: 107,494,529 E59G probably damaging Het
Nlrp10 T A 7: 108,925,198 E358D possibly damaging Het
Olfr1009 T A 2: 85,721,608 F68I probably damaging Het
Olfr107 T C 17: 37,406,204 F219L probably benign Het
Olfr1120 A G 2: 87,357,722 T93A probably benign Het
Olfr396-ps1 T A 11: 73,928,506 L94* probably null Het
Olfr525 T C 7: 140,322,846 I49T possibly damaging Het
Olfr846 T C 9: 19,361,283 E24G possibly damaging Het
Optn T C 2: 5,052,837 probably null Het
Plxna4 T A 6: 32,192,269 H1331L probably damaging Het
Poli A T 18: 70,516,849 M357K possibly damaging Het
Psd4 T G 2: 24,394,543 C140G possibly damaging Het
Rab3gap1 T A 1: 127,891,098 probably null Het
Rasa3 T C 8: 13,631,826 N41S probably benign Het
Rps6kc1 A G 1: 190,800,210 S532P probably benign Het
S100a3 T A 3: 90,602,440 probably null Het
Sfrp5 T C 19: 42,201,765 K83E possibly damaging Het
Slco1a4 T C 6: 141,834,708 I119V probably benign Het
Sorcs2 C A 5: 36,021,261 S1128I probably damaging Het
Tbc1d7 A T 13: 43,154,735 F85I probably damaging Het
Thoc7 A G 14: 13,953,528 Y46H probably damaging Het
Top1mt T A 15: 75,667,448 Y366F probably damaging Het
Trpv2 C A 11: 62,584,461 S233R probably benign Het
Vav1 C A 17: 57,279,268 T24N probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdfy4 G T 14: 32,964,626 probably null Het
Wdr3 A G 3: 100,154,997 S201P probably benign Het
Wdr34 A G 2: 30,038,266 V116A possibly damaging Het
Wfs1 C T 5: 36,966,950 D866N probably damaging Het
Wnk1 A T 6: 119,965,726 probably benign Het
Xpot G T 10: 121,602,399 Q762K probably benign Het
Zfp287 A T 11: 62,714,938 L370H possibly damaging Het
Other mutations in Snx15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Snx15 APN 19 6119885 missense probably benign 0.00
IGL02102:Snx15 APN 19 6122074 missense possibly damaging 0.69
PIT4418001:Snx15 UTSW 19 6123931 missense probably damaging 1.00
R0079:Snx15 UTSW 19 6123913 missense probably damaging 1.00
R0654:Snx15 UTSW 19 6121885 missense probably benign 0.33
R1499:Snx15 UTSW 19 6122064 missense probably damaging 1.00
R1943:Snx15 UTSW 19 6128066 missense probably damaging 1.00
R2991:Snx15 UTSW 19 6121485 missense probably damaging 0.99
R3769:Snx15 UTSW 19 6123954 splice site probably benign
R5117:Snx15 UTSW 19 6124151 critical splice donor site probably null
R5763:Snx15 UTSW 19 6122110 missense probably damaging 0.99
R6219:Snx15 UTSW 19 6121508 missense probably damaging 0.99
R7297:Snx15 UTSW 19 6120507 missense probably damaging 1.00
Z1088:Snx15 UTSW 19 6121411 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACAGATGTTCACGGTCCCTC -3'
(R):5'- GAAACAGATCCCAGCTGCTTC -3'

Sequencing Primer
(F):5'- ACGTTTGCTGGAACCGTC -3'
(R):5'- CCTTCTACTCAAGTGAATTCAGTGGG -3'
Posted On2019-05-13