Incidental Mutation 'R7025:Elk4'
ID545881
Institutional Source Beutler Lab
Gene Symbol Elk4
Ensembl Gene ENSMUSG00000026436
Gene NameELK4, member of ETS oncogene family
SynonymsSap1, A130026I01Rik, 2310011G17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock #R7025 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location132007607-132032612 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 132019369 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 366 (P366Q)
Ref Sequence ENSEMBL: ENSMUSP00000083743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027696] [ENSMUST00000086556] [ENSMUST00000126927] [ENSMUST00000146432]
Predicted Effect probably damaging
Transcript: ENSMUST00000027696
AA Change: P366Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027696
Gene: ENSMUSG00000026436
AA Change: P366Q

DomainStartEndE-ValueType
ETS 4 89 4.95e-58 SMART
low complexity region 147 158 N/A INTRINSIC
low complexity region 208 219 N/A INTRINSIC
low complexity region 245 264 N/A INTRINSIC
low complexity region 335 348 N/A INTRINSIC
low complexity region 360 373 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000086556
AA Change: P366Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083743
Gene: ENSMUSG00000026436
AA Change: P366Q

DomainStartEndE-ValueType
ETS 4 89 4.95e-58 SMART
low complexity region 147 158 N/A INTRINSIC
low complexity region 208 219 N/A INTRINSIC
low complexity region 245 264 N/A INTRINSIC
low complexity region 335 348 N/A INTRINSIC
low complexity region 360 373 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126927
SMART Domains Protein: ENSMUSP00000116706
Gene: ENSMUSG00000059149

DomainStartEndE-ValueType
Pfam:MFS_1 21 405 1.1e-11 PFAM
transmembrane domain 433 455 N/A INTRINSIC
transmembrane domain 460 482 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146432
SMART Domains Protein: ENSMUSP00000118880
Gene: ENSMUSG00000026436

DomainStartEndE-ValueType
ETS 4 89 4.95e-58 SMART
low complexity region 147 158 N/A INTRINSIC
low complexity region 208 219 N/A INTRINSIC
low complexity region 245 264 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000114255
Gene: ENSMUSG00000026436
AA Change: P225Q

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
low complexity region 68 79 N/A INTRINSIC
low complexity region 105 124 N/A INTRINSIC
low complexity region 195 208 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Ets family of transcription factors and of the ternary complex factor (TCF) subfamily. Proteins of the TCF subfamily form a ternary complex by binding to the the serum response factor and the serum reponse element in the promoter of the c-fos proto-oncogene. The protein encoded by this gene is phosphorylated by the kinases, MAPK1 and MAPK8. Several transcript variants have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutation of this locus impairs thymocyte positive selection and results in reduced numbers of single-positive thymocytes and peripheral T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd4 T A 11: 103,104,538 L90M probably damaging Het
Acot7 T C 4: 152,178,189 S7P unknown Het
Ahcyl2 T C 6: 29,908,421 Y388H probably damaging Het
Atp1a2 T A 1: 172,284,550 R593* probably null Het
Bicral T C 17: 46,801,668 T869A probably benign Het
Brca2 C T 5: 150,540,478 P1236S probably benign Het
Cacna2d1 C T 5: 16,352,668 Q699* probably null Het
Ccser2 T C 14: 36,940,007 N407D probably damaging Het
Cd300lg A G 11: 102,043,074 Y49C probably damaging Het
Cdh12 C A 15: 21,358,814 T108K probably damaging Het
Ctnnd1 A T 2: 84,610,606 I715K possibly damaging Het
Cyp17a1 T A 19: 46,670,980 D137V probably damaging Het
Dbr1 A G 9: 99,575,983 T19A probably damaging Het
Dnah3 C T 7: 120,030,010 A1441T possibly damaging Het
Dpt G A 1: 164,796,939 D70N probably damaging Het
Eml4 A C 17: 83,425,311 D131A probably benign Het
Faap24 A G 7: 35,392,871 I207T possibly damaging Het
Fam198b T C 3: 79,886,548 Y108H probably damaging Het
Fam219a T C 4: 41,521,925 S41G probably benign Het
Gm15448 T A 7: 3,821,262 K629* probably null Het
Ifi203 T C 1: 173,928,385 probably benign Het
Inpp4a T C 1: 37,369,423 V295A probably benign Het
Kif2a A G 13: 106,982,594 Y267H probably damaging Het
Kprp T A 3: 92,825,197 Q182L probably benign Het
Krt90 T C 15: 101,557,175 K337R possibly damaging Het
Lrp2 T A 2: 69,483,028 Y2453F possibly damaging Het
Magel2 A C 7: 62,379,787 Y813S unknown Het
Myh7 C A 14: 54,974,644 E1548* probably null Het
Myh8 A G 11: 67,297,539 T1009A probably benign Het
Nab2 T A 10: 127,666,508 probably benign Het
Neb T C 2: 52,296,273 D929G possibly damaging Het
Nelfb A C 2: 25,210,493 V155G probably damaging Het
Nmur1 C A 1: 86,387,848 M65I possibly damaging Het
Nop56 C T 2: 130,277,881 R81* probably null Het
Npnt C T 3: 132,908,396 C47Y probably damaging Het
Nrp1 G T 8: 128,480,954 C610F probably damaging Het
Olfr1175-ps T C 2: 88,323,262 K148E probably damaging Het
Olfr1243 T A 2: 89,527,604 I269F probably damaging Het
Olfr766-ps1 T A 10: 129,064,675 M1L probably benign Het
Pax5 G A 4: 44,679,501 Q93* probably null Het
Pcnt G T 10: 76,403,835 Q1273K probably damaging Het
Pde4dip G A 3: 97,724,183 Q1137* probably null Het
Pfas A T 11: 68,990,760 D959E probably benign Het
Prex1 TCCGACCCC TCCGACCCCGACCCC 2: 166,613,187 probably benign Het
Prpf40b C T 15: 99,306,400 Q182* probably null Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rpe65 A C 3: 159,622,685 E406A probably damaging Het
Serpina3k A T 12: 104,341,142 Y211F probably benign Het
Shkbp1 T C 7: 27,355,281 I65V possibly damaging Het
Slc22a29 G A 19: 8,160,580 P544S probably benign Het
Stab2 T C 10: 86,850,837 D2281G probably damaging Het
Tjp2 A G 19: 24,132,688 M64T probably benign Het
Tnfrsf8 C T 4: 145,274,403 V378I possibly damaging Het
Trpm1 A T 7: 64,226,714 probably null Het
Ubqln3 A G 7: 104,141,275 I536T probably benign Het
Vmn1r44 A G 6: 89,893,754 T161A possibly damaging Het
Vmn2r108 T A 17: 20,471,083 I393F possibly damaging Het
Other mutations in Elk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01798:Elk4 APN 1 132017854 missense possibly damaging 0.49
IGL02376:Elk4 APN 1 132014550 missense probably benign 0.27
IGL02503:Elk4 APN 1 132014539 missense probably damaging 1.00
IGL02620:Elk4 APN 1 132018371 missense probably benign 0.14
IGL03217:Elk4 APN 1 132018040 missense probably benign 0.09
R1386:Elk4 UTSW 1 132017830 missense probably damaging 1.00
R4937:Elk4 UTSW 1 132017681 missense probably damaging 1.00
R6958:Elk4 UTSW 1 132017832 missense probably damaging 1.00
R7189:Elk4 UTSW 1 132019389 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCTTTCTAGTTTGGGAAGACC -3'
(R):5'- AGTGGGCTATCAACTCTGCC -3'

Sequencing Primer
(F):5'- GGGAGGATCTAGTGTATGGA -3'
(R):5'- GGGCTATCAACTCTGCCCATTTC -3'
Posted On2019-05-13