Incidental Mutation 'R7025:Dpt'
ID545882
Institutional Source Beutler Lab
Gene Symbol Dpt
Ensembl Gene ENSMUSG00000026574
Gene Namedermatopontin
Synonymsearly quiescence protein-1, EQ-1, 1810032B19Rik, 5033416F05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R7025 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location164796644-164824266 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 164796939 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 70 (D70N)
Ref Sequence ENSEMBL: ENSMUSP00000027861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027861]
Predicted Effect probably damaging
Transcript: ENSMUST00000027861
AA Change: D70N

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027861
Gene: ENSMUSG00000026574
AA Change: D70N

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:DERM 40 196 1e-37 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dermatopontin is an extracellular matrix protein with possible functions in cell-matrix interactions and matrix assembly. The protein is found in various tissues and many of its tyrosine residues are sulphated. Dermatopontin is postulated to modify the behavior of TGF-beta through interaction with decorin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit skin with increased elasticity, decreased thickness, and reduced collagen content, and possess more subcutaneous adipose tissue. Corneal thickness is reduced as well. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd4 T A 11: 103,104,538 L90M probably damaging Het
Acot7 T C 4: 152,178,189 S7P unknown Het
Ahcyl2 T C 6: 29,908,421 Y388H probably damaging Het
Atp1a2 T A 1: 172,284,550 R593* probably null Het
Bicral T C 17: 46,801,668 T869A probably benign Het
Brca2 C T 5: 150,540,478 P1236S probably benign Het
Cacna2d1 C T 5: 16,352,668 Q699* probably null Het
Ccser2 T C 14: 36,940,007 N407D probably damaging Het
Cd300lg A G 11: 102,043,074 Y49C probably damaging Het
Cdh12 C A 15: 21,358,814 T108K probably damaging Het
Ctnnd1 A T 2: 84,610,606 I715K possibly damaging Het
Cyp17a1 T A 19: 46,670,980 D137V probably damaging Het
Dbr1 A G 9: 99,575,983 T19A probably damaging Het
Dnah3 C T 7: 120,030,010 A1441T possibly damaging Het
Elk4 C A 1: 132,019,369 P366Q probably damaging Het
Eml4 A C 17: 83,425,311 D131A probably benign Het
Faap24 A G 7: 35,392,871 I207T possibly damaging Het
Fam198b T C 3: 79,886,548 Y108H probably damaging Het
Fam219a T C 4: 41,521,925 S41G probably benign Het
Gm15448 T A 7: 3,821,262 K629* probably null Het
Ifi203 T C 1: 173,928,385 probably benign Het
Inpp4a T C 1: 37,369,423 V295A probably benign Het
Kif2a A G 13: 106,982,594 Y267H probably damaging Het
Kprp T A 3: 92,825,197 Q182L probably benign Het
Krt90 T C 15: 101,557,175 K337R possibly damaging Het
Lrp2 T A 2: 69,483,028 Y2453F possibly damaging Het
Magel2 A C 7: 62,379,787 Y813S unknown Het
Myh7 C A 14: 54,974,644 E1548* probably null Het
Myh8 A G 11: 67,297,539 T1009A probably benign Het
Nab2 T A 10: 127,666,508 probably benign Het
Neb T C 2: 52,296,273 D929G possibly damaging Het
Nelfb A C 2: 25,210,493 V155G probably damaging Het
Nmur1 C A 1: 86,387,848 M65I possibly damaging Het
Nop56 C T 2: 130,277,881 R81* probably null Het
Npnt C T 3: 132,908,396 C47Y probably damaging Het
Nrp1 G T 8: 128,480,954 C610F probably damaging Het
Olfr1175-ps T C 2: 88,323,262 K148E probably damaging Het
Olfr1243 T A 2: 89,527,604 I269F probably damaging Het
Olfr766-ps1 T A 10: 129,064,675 M1L probably benign Het
Pax5 G A 4: 44,679,501 Q93* probably null Het
Pcnt G T 10: 76,403,835 Q1273K probably damaging Het
Pde4dip G A 3: 97,724,183 Q1137* probably null Het
Pfas A T 11: 68,990,760 D959E probably benign Het
Prex1 TCCGACCCC TCCGACCCCGACCCC 2: 166,613,187 probably benign Het
Prpf40b C T 15: 99,306,400 Q182* probably null Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rpe65 A C 3: 159,622,685 E406A probably damaging Het
Serpina3k A T 12: 104,341,142 Y211F probably benign Het
Shkbp1 T C 7: 27,355,281 I65V possibly damaging Het
Slc22a29 G A 19: 8,160,580 P544S probably benign Het
Stab2 T C 10: 86,850,837 D2281G probably damaging Het
Tjp2 A G 19: 24,132,688 M64T probably benign Het
Tnfrsf8 C T 4: 145,274,403 V378I possibly damaging Het
Trpm1 A T 7: 64,226,714 probably null Het
Ubqln3 A G 7: 104,141,275 I536T probably benign Het
Vmn1r44 A G 6: 89,893,754 T161A possibly damaging Het
Vmn2r108 T A 17: 20,471,083 I393F possibly damaging Het
Other mutations in Dpt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Dpt APN 1 164796810 missense unknown
R3405:Dpt UTSW 1 164796931 missense probably damaging 1.00
R3406:Dpt UTSW 1 164796931 missense probably damaging 1.00
R4704:Dpt UTSW 1 164818949 nonsense probably null
R6558:Dpt UTSW 1 164796811 missense unknown
R7212:Dpt UTSW 1 164796915 missense probably benign 0.33
R7584:Dpt UTSW 1 164818908 missense probably benign 0.01
R7605:Dpt UTSW 1 164796831 missense unknown
Predicted Primers PCR Primer
(F):5'- GTTCTTCTGCCACTGGTGAC -3'
(R):5'- GCAATAGCAAGTTTAGGATGTGC -3'

Sequencing Primer
(F):5'- TTCTGCCACTGGTGACCACAG -3'
(R):5'- ATGAGCCCTGCTATTTTAAGGACC -3'
Posted On2019-05-13