Incidental Mutation 'R7025:Nelfb'
ID545885
Institutional Source Beutler Lab
Gene Symbol Nelfb
Ensembl Gene ENSMUSG00000013465
Gene Namenegative elongation factor complex member B
SynonymsA730008L03Rik, Cobra1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7025 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location25199712-25211489 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 25210493 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 155 (V155G)
Ref Sequence ENSEMBL: ENSMUSP00000057731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043774] [ENSMUST00000059849] [ENSMUST00000114363]
Predicted Effect probably benign
Transcript: ENSMUST00000043774
SMART Domains Protein: ENSMUSP00000037603
Gene: ENSMUSG00000036770

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 103 145 9.5e-4 PFAM
Pfam:SHIPPO-rpt 226 255 1.4e-3 PFAM
Pfam:SHIPPO-rpt 265 291 1.4e-3 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000059849
AA Change: V155G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000057731
Gene: ENSMUSG00000013465
AA Change: V155G

DomainStartEndE-ValueType
Pfam:COBRA1 107 578 3.5e-248 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114363
SMART Domains Protein: ENSMUSP00000110003
Gene: ENSMUSG00000036770

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 48 79 2.8e-4 PFAM
Pfam:SHIPPO-rpt 110 136 1.2e-1 PFAM
Pfam:SHIPPO-rpt 152 200 3.5e-1 PFAM
Pfam:SHIPPO-rpt 210 248 1.9e-3 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000115698
Gene: ENSMUSG00000013465
AA Change: V21G

DomainStartEndE-ValueType
Pfam:COBRA1 40 204 9.7e-106 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes subunit B of a metazoan-specific, four-subunit protein complex that regulates promoter-proximal pausing of RNA polymerase II. RNA polymerase II pausing is thought to be important for coordination of gene transcription during embryonic development and stress responses. Consistently, disruption of this gene in mouse causes inner cell mass deficiency and embryonic lethality. In addition, this gene is required for maintenance of mouse embryonic stem cells by preventing expression of developmental genes. In adult mice, conditional deletion of this gene results in cardiomyopathy and impaired response to cardiac stress. Multiple protein isoforms are encoded through the use of a non-AUG (CUG) initiation codon and an alternative downstream AUG initiation codon. In addition, alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a knock-out allele fail to develop inner cell masses and die between E5 and E13.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd4 T A 11: 103,104,538 L90M probably damaging Het
Acot7 T C 4: 152,178,189 S7P unknown Het
Ahcyl2 T C 6: 29,908,421 Y388H probably damaging Het
Atp1a2 T A 1: 172,284,550 R593* probably null Het
Bicral T C 17: 46,801,668 T869A probably benign Het
Brca2 C T 5: 150,540,478 P1236S probably benign Het
Cacna2d1 C T 5: 16,352,668 Q699* probably null Het
Ccser2 T C 14: 36,940,007 N407D probably damaging Het
Cd300lg A G 11: 102,043,074 Y49C probably damaging Het
Cdh12 C A 15: 21,358,814 T108K probably damaging Het
Ctnnd1 A T 2: 84,610,606 I715K possibly damaging Het
Cyp17a1 T A 19: 46,670,980 D137V probably damaging Het
Dbr1 A G 9: 99,575,983 T19A probably damaging Het
Dnah3 C T 7: 120,030,010 A1441T possibly damaging Het
Dpt G A 1: 164,796,939 D70N probably damaging Het
Elk4 C A 1: 132,019,369 P366Q probably damaging Het
Eml4 A C 17: 83,425,311 D131A probably benign Het
Faap24 A G 7: 35,392,871 I207T possibly damaging Het
Fam198b T C 3: 79,886,548 Y108H probably damaging Het
Fam219a T C 4: 41,521,925 S41G probably benign Het
Gm15448 T A 7: 3,821,262 K629* probably null Het
Ifi203 T C 1: 173,928,385 probably benign Het
Inpp4a T C 1: 37,369,423 V295A probably benign Het
Kif2a A G 13: 106,982,594 Y267H probably damaging Het
Kprp T A 3: 92,825,197 Q182L probably benign Het
Krt90 T C 15: 101,557,175 K337R possibly damaging Het
Lrp2 T A 2: 69,483,028 Y2453F possibly damaging Het
Magel2 A C 7: 62,379,787 Y813S unknown Het
Myh7 C A 14: 54,974,644 E1548* probably null Het
Myh8 A G 11: 67,297,539 T1009A probably benign Het
Nab2 T A 10: 127,666,508 probably benign Het
Neb T C 2: 52,296,273 D929G possibly damaging Het
Nmur1 C A 1: 86,387,848 M65I possibly damaging Het
Nop56 C T 2: 130,277,881 R81* probably null Het
Npnt C T 3: 132,908,396 C47Y probably damaging Het
Nrp1 G T 8: 128,480,954 C610F probably damaging Het
Olfr1175-ps T C 2: 88,323,262 K148E probably damaging Het
Olfr1243 T A 2: 89,527,604 I269F probably damaging Het
Olfr766-ps1 T A 10: 129,064,675 M1L probably benign Het
Pax5 G A 4: 44,679,501 Q93* probably null Het
Pcnt G T 10: 76,403,835 Q1273K probably damaging Het
Pde4dip G A 3: 97,724,183 Q1137* probably null Het
Pfas A T 11: 68,990,760 D959E probably benign Het
Prex1 TCCGACCCC TCCGACCCCGACCCC 2: 166,613,187 probably benign Het
Prpf40b C T 15: 99,306,400 Q182* probably null Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rpe65 A C 3: 159,622,685 E406A probably damaging Het
Serpina3k A T 12: 104,341,142 Y211F probably benign Het
Shkbp1 T C 7: 27,355,281 I65V possibly damaging Het
Slc22a29 G A 19: 8,160,580 P544S probably benign Het
Stab2 T C 10: 86,850,837 D2281G probably damaging Het
Tjp2 A G 19: 24,132,688 M64T probably benign Het
Tnfrsf8 C T 4: 145,274,403 V378I possibly damaging Het
Trpm1 A T 7: 64,226,714 probably null Het
Ubqln3 A G 7: 104,141,275 I536T probably benign Het
Vmn1r44 A G 6: 89,893,754 T161A possibly damaging Het
Vmn2r108 T A 17: 20,471,083 I393F possibly damaging Het
Other mutations in Nelfb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Nelfb APN 2 25204288 missense possibly damaging 0.94
IGL01573:Nelfb APN 2 25203957 missense probably damaging 1.00
IGL03109:Nelfb APN 2 25201061 missense possibly damaging 0.95
IGL03255:Nelfb APN 2 25203195 missense probably benign 0.21
R0541:Nelfb UTSW 2 25203980 missense probably benign 0.01
R2046:Nelfb UTSW 2 25206311 missense probably damaging 0.97
R4832:Nelfb UTSW 2 25209969 missense probably damaging 1.00
R4995:Nelfb UTSW 2 25206196 missense probably benign 0.01
R5299:Nelfb UTSW 2 25210745 missense probably benign 0.20
R5663:Nelfb UTSW 2 25203489 missense probably benign 0.01
R5854:Nelfb UTSW 2 25209993 missense probably damaging 1.00
R5987:Nelfb UTSW 2 25203888 missense probably damaging 1.00
R6747:Nelfb UTSW 2 25203381 missense probably benign 0.09
R8118:Nelfb UTSW 2 25205159 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCAACCAGGGGAAGTGTGTG -3'
(R):5'- GTCTCTACCAGGAAGCTGCTTATC -3'

Sequencing Primer
(F):5'- TGTGTGATATAAAGAAGGGGCCC -3'
(R):5'- CTACCAGGAAGCTGCTTATCTTTGTG -3'
Posted On2019-05-13