Incidental Mutation 'R7025:Olfr1243'
ID545890
Institutional Source Beutler Lab
Gene Symbol Olfr1243
Ensembl Gene ENSMUSG00000075084
Gene Nameolfactory receptor 1243
SynonymsGA_x6K02T2Q125-50972538-50971621, MOR231-4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R7025 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location89525889-89531487 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89527604 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 269 (I269F)
Ref Sequence ENSEMBL: ENSMUSP00000149464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099775] [ENSMUST00000144885]
Predicted Effect probably damaging
Transcript: ENSMUST00000099775
AA Change: I269F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097363
Gene: ENSMUSG00000075084
AA Change: I269F

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 3.5e-45 PFAM
Pfam:7TM_GPCR_Srsx 33 300 1.2e-5 PFAM
Pfam:7tm_1 39 285 2.1e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000144885
AA Change: I269F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd4 T A 11: 103,104,538 L90M probably damaging Het
Acot7 T C 4: 152,178,189 S7P unknown Het
Ahcyl2 T C 6: 29,908,421 Y388H probably damaging Het
Atp1a2 T A 1: 172,284,550 R593* probably null Het
Bicral T C 17: 46,801,668 T869A probably benign Het
Brca2 C T 5: 150,540,478 P1236S probably benign Het
Cacna2d1 C T 5: 16,352,668 Q699* probably null Het
Ccser2 T C 14: 36,940,007 N407D probably damaging Het
Cd300lg A G 11: 102,043,074 Y49C probably damaging Het
Cdh12 C A 15: 21,358,814 T108K probably damaging Het
Ctnnd1 A T 2: 84,610,606 I715K possibly damaging Het
Cyp17a1 T A 19: 46,670,980 D137V probably damaging Het
Dbr1 A G 9: 99,575,983 T19A probably damaging Het
Dnah3 C T 7: 120,030,010 A1441T possibly damaging Het
Dpt G A 1: 164,796,939 D70N probably damaging Het
Elk4 C A 1: 132,019,369 P366Q probably damaging Het
Eml4 A C 17: 83,425,311 D131A probably benign Het
Faap24 A G 7: 35,392,871 I207T possibly damaging Het
Fam198b T C 3: 79,886,548 Y108H probably damaging Het
Fam219a T C 4: 41,521,925 S41G probably benign Het
Gm15448 T A 7: 3,821,262 K629* probably null Het
Ifi203 T C 1: 173,928,385 probably benign Het
Inpp4a T C 1: 37,369,423 V295A probably benign Het
Kif2a A G 13: 106,982,594 Y267H probably damaging Het
Kprp T A 3: 92,825,197 Q182L probably benign Het
Krt90 T C 15: 101,557,175 K337R possibly damaging Het
Lrp2 T A 2: 69,483,028 Y2453F possibly damaging Het
Magel2 A C 7: 62,379,787 Y813S unknown Het
Myh7 C A 14: 54,974,644 E1548* probably null Het
Myh8 A G 11: 67,297,539 T1009A probably benign Het
Nab2 T A 10: 127,666,508 probably benign Het
Neb T C 2: 52,296,273 D929G possibly damaging Het
Nelfb A C 2: 25,210,493 V155G probably damaging Het
Nmur1 C A 1: 86,387,848 M65I possibly damaging Het
Nop56 C T 2: 130,277,881 R81* probably null Het
Npnt C T 3: 132,908,396 C47Y probably damaging Het
Nrp1 G T 8: 128,480,954 C610F probably damaging Het
Olfr1175-ps T C 2: 88,323,262 K148E probably damaging Het
Olfr766-ps1 T A 10: 129,064,675 M1L probably benign Het
Pax5 G A 4: 44,679,501 Q93* probably null Het
Pcnt G T 10: 76,403,835 Q1273K probably damaging Het
Pde4dip G A 3: 97,724,183 Q1137* probably null Het
Pfas A T 11: 68,990,760 D959E probably benign Het
Prex1 TCCGACCCC TCCGACCCCGACCCC 2: 166,613,187 probably benign Het
Prpf40b C T 15: 99,306,400 Q182* probably null Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rpe65 A C 3: 159,622,685 E406A probably damaging Het
Serpina3k A T 12: 104,341,142 Y211F probably benign Het
Shkbp1 T C 7: 27,355,281 I65V possibly damaging Het
Slc22a29 G A 19: 8,160,580 P544S probably benign Het
Stab2 T C 10: 86,850,837 D2281G probably damaging Het
Tjp2 A G 19: 24,132,688 M64T probably benign Het
Tnfrsf8 C T 4: 145,274,403 V378I possibly damaging Het
Trpm1 A T 7: 64,226,714 probably null Het
Ubqln3 A G 7: 104,141,275 I536T probably benign Het
Vmn1r44 A G 6: 89,893,754 T161A possibly damaging Het
Vmn2r108 T A 17: 20,471,083 I393F possibly damaging Het
Other mutations in Olfr1243
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Olfr1243 APN 2 89528207 missense probably damaging 1.00
IGL01940:Olfr1243 APN 2 89527810 missense probably damaging 0.99
IGL02553:Olfr1243 APN 2 89527931 missense probably benign
R0105:Olfr1243 UTSW 2 89528363 missense probably benign 0.00
R0105:Olfr1243 UTSW 2 89528363 missense probably benign 0.00
R0607:Olfr1243 UTSW 2 89528107 missense possibly damaging 0.88
R0764:Olfr1243 UTSW 2 89527996 missense probably benign 0.05
R1779:Olfr1243 UTSW 2 89527645 missense probably benign 0.15
R2221:Olfr1243 UTSW 2 89527937 missense probably benign 0.05
R3853:Olfr1243 UTSW 2 89527573 missense possibly damaging 0.94
R3886:Olfr1243 UTSW 2 89527732 missense possibly damaging 0.81
R3887:Olfr1243 UTSW 2 89527732 missense possibly damaging 0.81
R3888:Olfr1243 UTSW 2 89527732 missense possibly damaging 0.81
R4431:Olfr1243 UTSW 2 89527643 missense probably damaging 1.00
R4479:Olfr1243 UTSW 2 89528170 missense possibly damaging 0.89
R6807:Olfr1243 UTSW 2 89527588 missense probably damaging 1.00
R7094:Olfr1243 UTSW 2 89527558 missense probably damaging 1.00
R7144:Olfr1243 UTSW 2 89527557 missense probably damaging 1.00
R7972:Olfr1243 UTSW 2 89527604 missense probably benign 0.02
R8013:Olfr1243 UTSW 2 89527936 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GAGCACAGCATCCCTTGTTAG -3'
(R):5'- TCACTGTCATTGCCAATGGTG -3'

Sequencing Primer
(F):5'- GCACAGCATCCCTTGTTAGAATTTAC -3'
(R):5'- AATCTGTGTGGGAATTTTCACC -3'
Posted On2019-05-13