Incidental Mutation 'R7025:Pax5'
ID545899
Institutional Source Beutler Lab
Gene Symbol Pax5
Ensembl Gene ENSMUSG00000014030
Gene Namepaired box 5
SynonymsPax-5, EBB-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7025 (G1)
Quality Score218.009
Status Not validated
Chromosome4
Chromosomal Location44524757-44710487 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 44679501 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 93 (Q93*)
Ref Sequence ENSEMBL: ENSMUSP00000141186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014174] [ENSMUST00000102932] [ENSMUST00000107825] [ENSMUST00000107826] [ENSMUST00000107827] [ENSMUST00000134968] [ENSMUST00000143235] [ENSMUST00000146335] [ENSMUST00000165417] [ENSMUST00000173733] [ENSMUST00000186542] [ENSMUST00000173821] [ENSMUST00000174242]
Predicted Effect silent
Transcript: ENSMUST00000014174
SMART Domains Protein: ENSMUSP00000014174
Gene: ENSMUSG00000014030

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
low complexity region 157 189 N/A INTRINSIC
SCOP:d1ftt__ 220 254 1e-4 SMART
Pfam:Pax2_C 279 390 6e-53 PFAM
Predicted Effect silent
Transcript: ENSMUST00000102932
SMART Domains Protein: ENSMUSP00000099996
Gene: ENSMUSG00000014030

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
low complexity region 157 189 N/A INTRINSIC
SCOP:d1ftt__ 220 254 1e-4 SMART
Pfam:Pax2_C 276 341 1.1e-25 PFAM
Predicted Effect silent
Transcript: ENSMUST00000107825
SMART Domains Protein: ENSMUSP00000103455
Gene: ENSMUSG00000014030

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
low complexity region 157 189 N/A INTRINSIC
SCOP:d1ftt__ 220 254 2e-4 SMART
Pfam:Pax2_C 279 356 5.7e-28 PFAM
Predicted Effect silent
Transcript: ENSMUST00000107826
SMART Domains Protein: ENSMUSP00000103457
Gene: ENSMUSG00000014030

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
low complexity region 157 189 N/A INTRINSIC
SCOP:d1ftt__ 220 254 7e-4 SMART
low complexity region 269 281 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000107827
SMART Domains Protein: ENSMUSP00000103458
Gene: ENSMUSG00000014030

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
low complexity region 157 189 N/A INTRINSIC
SCOP:d1ftt__ 220 254 4e-4 SMART
low complexity region 298 310 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134968
SMART Domains Protein: ENSMUSP00000133540
Gene: ENSMUSG00000014030

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
SCOP:d1ftt__ 177 211 1e-4 SMART
Pfam:Pax2_C 233 298 2.4e-25 PFAM
Predicted Effect silent
Transcript: ENSMUST00000143235
SMART Domains Protein: ENSMUSP00000134370
Gene: ENSMUSG00000014030

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
low complexity region 157 189 N/A INTRINSIC
SCOP:d1ftt__ 220 254 1e-3 SMART
Predicted Effect silent
Transcript: ENSMUST00000146335
SMART Domains Protein: ENSMUSP00000139296
Gene: ENSMUSG00000014030

DomainStartEndE-ValueType
PAX 15 139 8e-96 SMART
low complexity region 156 188 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165417
SMART Domains Protein: ENSMUSP00000128880
Gene: ENSMUSG00000014030

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
SCOP:d1ftt__ 177 211 1e-4 SMART
Pfam:Pax2_C 233 347 7.3e-55 PFAM
Predicted Effect silent
Transcript: ENSMUST00000172866
SMART Domains Protein: ENSMUSP00000134119
Gene: ENSMUSG00000014030

DomainStartEndE-ValueType
PAX 4 85 2.44e-27 SMART
low complexity region 102 134 N/A INTRINSIC
SCOP:d1ftt__ 165 199 7e-5 SMART
Pfam:Pax2_C 224 335 2.3e-53 PFAM
Predicted Effect silent
Transcript: ENSMUST00000173733
SMART Domains Protein: ENSMUSP00000133671
Gene: ENSMUSG00000014030

DomainStartEndE-ValueType
PAX 16 120 2.93e-30 SMART
SCOP:d1ftt__ 154 188 1e-4 SMART
Pfam:Pax2_C 212 290 8.7e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000186542
AA Change: Q93*
SMART Domains Protein: ENSMUSP00000141186
Gene: ENSMUSG00000014030
AA Change: Q93*

DomainStartEndE-ValueType
PAX 15 108 1.2e-22 SMART
Predicted Effect silent
Transcript: ENSMUST00000173821
SMART Domains Protein: ENSMUSP00000134712
Gene: ENSMUSG00000014030

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
low complexity region 157 189 N/A INTRINSIC
SCOP:d1ftt__ 220 254 2e-4 SMART
low complexity region 306 325 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000174242
SMART Domains Protein: ENSMUSP00000134391
Gene: ENSMUSG00000014030

DomainStartEndE-ValueType
PAX 16 140 4.92e-96 SMART
low complexity region 157 189 N/A INTRINSIC
SCOP:d1ftt__ 220 254 2e-3 SMART
Predicted Effect silent
Transcript: ENSMUST00000174319
SMART Domains Protein: ENSMUSP00000133978
Gene: ENSMUSG00000014030

DomainStartEndE-ValueType
PAX 4 85 2.44e-27 SMART
low complexity region 102 134 N/A INTRINSIC
SCOP:d1ftt__ 165 199 2e-4 SMART
low complexity region 251 270 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the paired box (PAX) family of transcription factors. The central feature of this gene family is a novel, highly conserved DNA-binding motif, known as the paired box. Paired box transcription factors are important regulators in early development, and alterations in the expression of their genes are thought to contribute to neoplastic transformation. This gene encodes the B-cell lineage specific activator protein that is expressed at early, but not late stages of B-cell differentiation. Its expression has also been detected in developing CNS and testis and so the encoded protein may also play a role in neural development and spermatogenesis. This gene is located at 9p13, which is involved in t(9;14)(p13;q32) translocations recurring in small lymphocytic lymphomas of the plasmacytoid subtype, and in derived large-cell lymphomas. This translocation brings the potent E-mu enhancer of the IgH gene into close proximity of the PAX5 promoter, suggesting that the deregulation of transcription of this gene contributes to the pathogenesis of these lymphomas. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
PHENOTYPE: Null mutants exhibit impaired development of the midbrain resulting in a reduced inferior colliculus and an altered cerebellar folial pattern, failure of B cell differentiation, runting, and high postnatal mortality with few survivors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd4 T A 11: 103,104,538 L90M probably damaging Het
Acot7 T C 4: 152,178,189 S7P unknown Het
Ahcyl2 T C 6: 29,908,421 Y388H probably damaging Het
Atp1a2 T A 1: 172,284,550 R593* probably null Het
Bicral T C 17: 46,801,668 T869A probably benign Het
Brca2 C T 5: 150,540,478 P1236S probably benign Het
Cacna2d1 C T 5: 16,352,668 Q699* probably null Het
Ccser2 T C 14: 36,940,007 N407D probably damaging Het
Cd300lg A G 11: 102,043,074 Y49C probably damaging Het
Cdh12 C A 15: 21,358,814 T108K probably damaging Het
Ctnnd1 A T 2: 84,610,606 I715K possibly damaging Het
Cyp17a1 T A 19: 46,670,980 D137V probably damaging Het
Dbr1 A G 9: 99,575,983 T19A probably damaging Het
Dnah3 C T 7: 120,030,010 A1441T possibly damaging Het
Dpt G A 1: 164,796,939 D70N probably damaging Het
Elk4 C A 1: 132,019,369 P366Q probably damaging Het
Eml4 A C 17: 83,425,311 D131A probably benign Het
Faap24 A G 7: 35,392,871 I207T possibly damaging Het
Fam198b T C 3: 79,886,548 Y108H probably damaging Het
Fam219a T C 4: 41,521,925 S41G probably benign Het
Gm15448 T A 7: 3,821,262 K629* probably null Het
Ifi203 T C 1: 173,928,385 probably benign Het
Inpp4a T C 1: 37,369,423 V295A probably benign Het
Kif2a A G 13: 106,982,594 Y267H probably damaging Het
Kprp T A 3: 92,825,197 Q182L probably benign Het
Krt90 T C 15: 101,557,175 K337R possibly damaging Het
Lrp2 T A 2: 69,483,028 Y2453F possibly damaging Het
Magel2 A C 7: 62,379,787 Y813S unknown Het
Myh7 C A 14: 54,974,644 E1548* probably null Het
Myh8 A G 11: 67,297,539 T1009A probably benign Het
Nab2 T A 10: 127,666,508 probably benign Het
Neb T C 2: 52,296,273 D929G possibly damaging Het
Nelfb A C 2: 25,210,493 V155G probably damaging Het
Nmur1 C A 1: 86,387,848 M65I possibly damaging Het
Nop56 C T 2: 130,277,881 R81* probably null Het
Npnt C T 3: 132,908,396 C47Y probably damaging Het
Nrp1 G T 8: 128,480,954 C610F probably damaging Het
Olfr1175-ps T C 2: 88,323,262 K148E probably damaging Het
Olfr1243 T A 2: 89,527,604 I269F probably damaging Het
Olfr766-ps1 T A 10: 129,064,675 M1L probably benign Het
Pcnt G T 10: 76,403,835 Q1273K probably damaging Het
Pde4dip G A 3: 97,724,183 Q1137* probably null Het
Pfas A T 11: 68,990,760 D959E probably benign Het
Prex1 TCCGACCCC TCCGACCCCGACCCC 2: 166,613,187 probably benign Het
Prpf40b C T 15: 99,306,400 Q182* probably null Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rpe65 A C 3: 159,622,685 E406A probably damaging Het
Serpina3k A T 12: 104,341,142 Y211F probably benign Het
Shkbp1 T C 7: 27,355,281 I65V possibly damaging Het
Slc22a29 G A 19: 8,160,580 P544S probably benign Het
Stab2 T C 10: 86,850,837 D2281G probably damaging Het
Tjp2 A G 19: 24,132,688 M64T probably benign Het
Tnfrsf8 C T 4: 145,274,403 V378I possibly damaging Het
Trpm1 A T 7: 64,226,714 probably null Het
Ubqln3 A G 7: 104,141,275 I536T probably benign Het
Vmn1r44 A G 6: 89,893,754 T161A possibly damaging Het
Vmn2r108 T A 17: 20,471,083 I393F possibly damaging Het
Other mutations in Pax5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02369:Pax5 APN 4 44691919 missense probably damaging 1.00
IGL02700:Pax5 APN 4 44682722 missense probably damaging 0.99
IGL02754:Pax5 APN 4 44570059 missense probably damaging 0.96
apple UTSW 4 unclassified
Glacier UTSW 4 44679494 missense probably damaging 1.00
glacier2 UTSW 4 44710407 start codon destroyed probably null 0.96
Glacier3 UTSW 4 44679526 missense probably damaging 1.00
k2 UTSW 4 44697630 missense probably damaging 1.00
Son_of_apple UTSW 4 44710583 unclassified probably benign
R0411:Pax5 UTSW 4 44609783 missense probably damaging 0.99
R0415:Pax5 UTSW 4 44691886 missense probably damaging 1.00
R0655:Pax5 UTSW 4 44537462 missense probably damaging 0.97
R1146:Pax5 UTSW 4 44697512 splice site probably benign
R1752:Pax5 UTSW 4 44609729 missense probably damaging 1.00
R1891:Pax5 UTSW 4 44691859 missense probably damaging 1.00
R4766:Pax5 UTSW 4 44679494 missense probably damaging 1.00
R4783:Pax5 UTSW 4 44570086 missense probably damaging 1.00
R5134:Pax5 UTSW 4 44710407 start codon destroyed probably null 0.96
R5341:Pax5 UTSW 4 44697630 missense probably damaging 1.00
R5458:Pax5 UTSW 4 44679526 missense probably damaging 1.00
R6281:Pax5 UTSW 4 44691955 missense probably benign 0.37
R6871:Pax5 UTSW 4 44710583 unclassified probably benign
R7204:Pax5 UTSW 4 44679485 missense possibly damaging 0.93
R7975:Pax5 UTSW 4 44537465 missense probably damaging 0.98
R8246:Pax5 UTSW 4 44570027 missense probably benign 0.08
R8527:Pax5 UTSW 4 44570071 missense probably damaging 1.00
R8542:Pax5 UTSW 4 44570071 missense probably damaging 1.00
S24628:Pax5 UTSW 4 44691886 missense probably damaging 1.00
X0018:Pax5 UTSW 4 44691880 missense probably damaging 1.00
Z1176:Pax5 UTSW 4 44697678 missense probably damaging 1.00
Z1177:Pax5 UTSW 4 44697558 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCAGCTAAGCATGTCGTAC -3'
(R):5'- CTGGCTGGGATCTTAGTAAATTCC -3'

Sequencing Primer
(F):5'- GCTAAGCATGTCGTACTGCAC -3'
(R):5'- CCCTTTCTGCTGGGTCGG -3'
Posted On2019-05-13