Mutagenetix > Incidental Mutations

Incidental Mutation 'R7025:Acot7'

545901

Institutional Source

Beutler Lab

Gene Symbol

Acot7

Ensembl Gene

ENSMUSG00000028937

Gene Name

acyl-CoA thioesterase 7

Synonyms

2410041A17Rik, Bach, AU014716

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.148) question?

Stock #

R7025 (G1)

Quality Score

120.008

Status

Not validated

Chromosome

Chromosomal Location

152178134-152271855 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 152178189 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 7 (S7P)

Ref Sequence

ENSEMBL: ENSMUSP00000074827 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075363]

Predicted Effect

unknown
Transcript: ENSMUST00000075363
AA Change: S7P

SMART Domains

Protein: ENSMUSP00000074827
Gene: ENSMUSG00000028937
AA Change: S7P

Domain	Start	End	E-Value	Type
low complexity region	1	13	N/A	INTRINSIC
low complexity region	30	36	N/A	INTRINSIC
Pfam:4HBT	67	150	1.2e-16	PFAM
Pfam:4HBT	241	316	5e-19	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acyl coenzyme family. The encoded protein hydrolyzes the CoA thioester of palmitoyl-CoA and other long-chain fatty acids. Decreased expression of this gene may be associated with mesial temporal lobe epilepsy. Alternatively spliced transcript variants encoding distinct isoforms with different subcellular locations have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a floxed allele activated in neurons exhibit abnormal glucose and lipid homeostasis, altered metabolism, increaased adiposity, decreased lean mass, progressive neurodegeneration, and neurological defects in aged mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acbd4	T	A	11: 103,104,538	L90M	probably damaging	Het
Ahcyl2	T	C	6: 29,908,421	Y388H	probably damaging	Het
Atp1a2	T	A	1: 172,284,550	R593*	probably null	Het
Bicral	T	C	17: 46,801,668	T869A	probably benign	Het
Brca2	C	T	5: 150,540,478	P1236S	probably benign	Het
Cacna2d1	C	T	5: 16,352,668	Q699*	probably null	Het
Ccser2	T	C	14: 36,940,007	N407D	probably damaging	Het
Cd300lg	A	G	11: 102,043,074	Y49C	probably damaging	Het
Cdh12	C	A	15: 21,358,814	T108K	probably damaging	Het
Ctnnd1	A	T	2: 84,610,606	I715K	possibly damaging	Het
Cyp17a1	T	A	19: 46,670,980	D137V	probably damaging	Het
Dbr1	A	G	9: 99,575,983	T19A	probably damaging	Het
Dnah3	C	T	7: 120,030,010	A1441T	possibly damaging	Het
Dpt	G	A	1: 164,796,939	D70N	probably damaging	Het
Elk4	C	A	1: 132,019,369	P366Q	probably damaging	Het
Eml4	A	C	17: 83,425,311	D131A	probably benign	Het
Faap24	A	G	7: 35,392,871	I207T	possibly damaging	Het
Fam198b	T	C	3: 79,886,548	Y108H	probably damaging	Het
Fam219a	T	C	4: 41,521,925	S41G	probably benign	Het
Gm15448	T	A	7: 3,821,262	K629*	probably null	Het
Ifi203	T	C	1: 173,928,385		probably benign	Het
Inpp4a	T	C	1: 37,369,423	V295A	probably benign	Het
Kif2a	A	G	13: 106,982,594	Y267H	probably damaging	Het
Kprp	T	A	3: 92,825,197	Q182L	probably benign	Het
Krt90	T	C	15: 101,557,175	K337R	possibly damaging	Het
Lrp2	T	A	2: 69,483,028	Y2453F	possibly damaging	Het
Magel2	A	C	7: 62,379,787	Y813S	unknown	Het
Myh7	C	A	14: 54,974,644	E1548*	probably null	Het
Myh8	A	G	11: 67,297,539	T1009A	probably benign	Het
Nab2	T	A	10: 127,666,508		probably benign	Het
Neb	T	C	2: 52,296,273	D929G	possibly damaging	Het
Nelfb	A	C	2: 25,210,493	V155G	probably damaging	Het
Nmur1	C	A	1: 86,387,848	M65I	possibly damaging	Het
Nop56	C	T	2: 130,277,881	R81*	probably null	Het
Npnt	C	T	3: 132,908,396	C47Y	probably damaging	Het
Nrp1	G	T	8: 128,480,954	C610F	probably damaging	Het
Olfr1175-ps	T	C	2: 88,323,262	K148E	probably damaging	Het
Olfr1243	T	A	2: 89,527,604	I269F	probably damaging	Het
Olfr766-ps1	T	A	10: 129,064,675	M1L	probably benign	Het
Pax5	G	A	4: 44,679,501	Q93*	probably null	Het
Pcnt	G	T	10: 76,403,835	Q1273K	probably damaging	Het
Pde4dip	G	A	3: 97,724,183	Q1137*	probably null	Het
Pfas	A	T	11: 68,990,760	D959E	probably benign	Het
Prex1	TCCGACCCC	TCCGACCCCGACCCC	2: 166,613,187		probably benign	Het
Prpf40b	C	T	15: 99,306,400	Q182*	probably null	Het
Ptk2	G	A	15: 73,221,809	P854S	possibly damaging	Het
Rpe65	A	C	3: 159,622,685	E406A	probably damaging	Het
Serpina3k	A	T	12: 104,341,142	Y211F	probably benign	Het
Shkbp1	T	C	7: 27,355,281	I65V	possibly damaging	Het
Slc22a29	G	A	19: 8,160,580	P544S	probably benign	Het
Stab2	T	C	10: 86,850,837	D2281G	probably damaging	Het
Tjp2	A	G	19: 24,132,688	M64T	probably benign	Het
Tnfrsf8	C	T	4: 145,274,403	V378I	possibly damaging	Het
Trpm1	A	T	7: 64,226,714		probably null	Het
Ubqln3	A	G	7: 104,141,275	I536T	probably benign	Het
Vmn1r44	A	G	6: 89,893,754	T161A	possibly damaging	Het
Vmn2r108	T	A	17: 20,471,083	I393F	possibly damaging	Het

Other mutations in Acot7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01308:Acot7	APN	4	152260896	missense	probably benign	0.39
IGL01758:Acot7	APN	4	152217793	missense	probably damaging	0.96
IGL01991:Acot7	APN	4	152223079	missense	possibly damaging	0.84
R1329:Acot7	UTSW	4	152229784	nonsense	probably null
R1605:Acot7	UTSW	4	152206828	missense	possibly damaging	0.46
R1625:Acot7	UTSW	4	152186291	missense	probably benign	0.01
R1739:Acot7	UTSW	4	152260912	missense	probably damaging	1.00
R4169:Acot7	UTSW	4	152217793	missense	probably damaging	0.96
R4473:Acot7	UTSW	4	152206856	missense	probably damaging	1.00
R4857:Acot7	UTSW	4	152237754	missense	possibly damaging	0.76
R4884:Acot7	UTSW	4	152186207	intron	probably benign
R5000:Acot7	UTSW	4	152186363	missense	probably benign	0.00
R6123:Acot7	UTSW	4	152199945	missense	probably benign
R6633:Acot7	UTSW	4	152178259	missense	probably benign
R6938:Acot7	UTSW	4	152217894	critical splice donor site	probably null
R7813:Acot7	UTSW	4	152223118	missense	probably damaging	1.00
R8035:Acot7	UTSW	4	152253154	missense	possibly damaging	0.75

Predicted Primers

PCR Primer
(F):5'- AACCTTCTGGAAGCGGAGTC -3'
(R):5'- TCAGGATGAAGGCAGCATC -3'

Sequencing Primer
(F):5'- TGGAAGCGGAGTCCCACAG -3'
(R):5'- ATCCTTCAGCCTCAGCGAG -3'

Posted On

2019-05-13