Incidental Mutation 'R7025:Cacna2d1'
ID545902
Institutional Source Beutler Lab
Gene Symbol Cacna2d1
Ensembl Gene ENSMUSG00000040118
Gene Namecalcium channel, voltage-dependent, alpha2/delta subunit 1
SynonymsCa(v)alpha2delta1, Cacna2, Cchl2a
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.339) question?
Stock #R7025 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location15934691-16374511 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 16352668 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 699 (Q699*)
Ref Sequence ENSEMBL: ENSMUSP00000142881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039370] [ENSMUST00000078272] [ENSMUST00000101581] [ENSMUST00000115281] [ENSMUST00000167946] [ENSMUST00000180204] [ENSMUST00000199704]
Predicted Effect probably null
Transcript: ENSMUST00000039370
AA Change: Q723*
SMART Domains Protein: ENSMUSP00000049457
Gene: ENSMUSG00000040118
AA Change: Q723*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 6.3e-42 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 536 1e-31 PFAM
Pfam:VGCC_alpha2 562 655 1e-46 PFAM
low complexity region 675 686 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000078272
AA Change: Q704*
SMART Domains Protein: ENSMUSP00000077391
Gene: ENSMUSG00000040118
AA Change: Q704*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 1.2e-45 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 537 1.1e-30 PFAM
Pfam:VGCC_alpha2 543 634 3.3e-53 PFAM
low complexity region 656 667 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000101581
AA Change: Q711*
SMART Domains Protein: ENSMUSP00000099117
Gene: ENSMUSG00000040118
AA Change: Q711*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 1.2e-45 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 537 1.1e-30 PFAM
Pfam:VGCC_alpha2 543 636 1.2e-59 PFAM
low complexity region 663 674 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115281
AA Change: Q706*
SMART Domains Protein: ENSMUSP00000110936
Gene: ENSMUSG00000040118
AA Change: Q706*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 6.2e-46 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 533 3.8e-30 PFAM
Pfam:VGCC_alpha2 538 631 6.2e-60 PFAM
low complexity region 658 669 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000167946
AA Change: Q711*
SMART Domains Protein: ENSMUSP00000131507
Gene: ENSMUSG00000040118
AA Change: Q711*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 3.8e-46 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 537 2.6e-30 PFAM
Pfam:VGCC_alpha2 543 636 5.5e-56 PFAM
low complexity region 663 674 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000180204
AA Change: Q706*
SMART Domains Protein: ENSMUSP00000136260
Gene: ENSMUSG00000040118
AA Change: Q706*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 6.2e-46 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 533 3.8e-30 PFAM
Pfam:VGCC_alpha2 538 631 6.2e-60 PFAM
low complexity region 658 669 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000199704
AA Change: Q699*
SMART Domains Protein: ENSMUSP00000142881
Gene: ENSMUSG00000040118
AA Change: Q699*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:VWA_N 104 223 1.2e-45 PFAM
VWA 251 425 5.16e-25 SMART
Pfam:Cache_1 446 533 6.3e-30 PFAM
Pfam:VGCC_alpha2 538 629 3.3e-53 PFAM
low complexity region 651 662 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a regulatory component of the voltage-dependent calcium channel complex. The product of this gene is a proprotein that is proteolytically processed into alpha-2 and delta subunits, which are linked by a disulfide bond. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice with a point mutation allele exhibit abnormal CNS synaptic transmission and decreased response to pregabalin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd4 T A 11: 103,104,538 L90M probably damaging Het
Acot7 T C 4: 152,178,189 S7P unknown Het
Ahcyl2 T C 6: 29,908,421 Y388H probably damaging Het
Atp1a2 T A 1: 172,284,550 R593* probably null Het
Bicral T C 17: 46,801,668 T869A probably benign Het
Brca2 C T 5: 150,540,478 P1236S probably benign Het
Ccser2 T C 14: 36,940,007 N407D probably damaging Het
Cd300lg A G 11: 102,043,074 Y49C probably damaging Het
Cdh12 C A 15: 21,358,814 T108K probably damaging Het
Ctnnd1 A T 2: 84,610,606 I715K possibly damaging Het
Cyp17a1 T A 19: 46,670,980 D137V probably damaging Het
Dbr1 A G 9: 99,575,983 T19A probably damaging Het
Dnah3 C T 7: 120,030,010 A1441T possibly damaging Het
Dpt G A 1: 164,796,939 D70N probably damaging Het
Elk4 C A 1: 132,019,369 P366Q probably damaging Het
Eml4 A C 17: 83,425,311 D131A probably benign Het
Faap24 A G 7: 35,392,871 I207T possibly damaging Het
Fam198b T C 3: 79,886,548 Y108H probably damaging Het
Fam219a T C 4: 41,521,925 S41G probably benign Het
Gm15448 T A 7: 3,821,262 K629* probably null Het
Ifi203 T C 1: 173,928,385 probably benign Het
Inpp4a T C 1: 37,369,423 V295A probably benign Het
Kif2a A G 13: 106,982,594 Y267H probably damaging Het
Kprp T A 3: 92,825,197 Q182L probably benign Het
Krt90 T C 15: 101,557,175 K337R possibly damaging Het
Lrp2 T A 2: 69,483,028 Y2453F possibly damaging Het
Magel2 A C 7: 62,379,787 Y813S unknown Het
Myh7 C A 14: 54,974,644 E1548* probably null Het
Myh8 A G 11: 67,297,539 T1009A probably benign Het
Nab2 T A 10: 127,666,508 probably benign Het
Neb T C 2: 52,296,273 D929G possibly damaging Het
Nelfb A C 2: 25,210,493 V155G probably damaging Het
Nmur1 C A 1: 86,387,848 M65I possibly damaging Het
Nop56 C T 2: 130,277,881 R81* probably null Het
Npnt C T 3: 132,908,396 C47Y probably damaging Het
Nrp1 G T 8: 128,480,954 C610F probably damaging Het
Olfr1175-ps T C 2: 88,323,262 K148E probably damaging Het
Olfr1243 T A 2: 89,527,604 I269F probably damaging Het
Olfr766-ps1 T A 10: 129,064,675 M1L probably benign Het
Pax5 G A 4: 44,679,501 Q93* probably null Het
Pcnt G T 10: 76,403,835 Q1273K probably damaging Het
Pde4dip G A 3: 97,724,183 Q1137* probably null Het
Pfas A T 11: 68,990,760 D959E probably benign Het
Prex1 TCCGACCCC TCCGACCCCGACCCC 2: 166,613,187 probably benign Het
Prpf40b C T 15: 99,306,400 Q182* probably null Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rpe65 A C 3: 159,622,685 E406A probably damaging Het
Serpina3k A T 12: 104,341,142 Y211F probably benign Het
Shkbp1 T C 7: 27,355,281 I65V possibly damaging Het
Slc22a29 G A 19: 8,160,580 P544S probably benign Het
Stab2 T C 10: 86,850,837 D2281G probably damaging Het
Tjp2 A G 19: 24,132,688 M64T probably benign Het
Tnfrsf8 C T 4: 145,274,403 V378I possibly damaging Het
Trpm1 A T 7: 64,226,714 probably null Het
Ubqln3 A G 7: 104,141,275 I536T probably benign Het
Vmn1r44 A G 6: 89,893,754 T161A possibly damaging Het
Vmn2r108 T A 17: 20,471,083 I393F possibly damaging Het
Other mutations in Cacna2d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Cacna2d1 APN 5 16212944 missense probably damaging 1.00
IGL00470:Cacna2d1 APN 5 16246656 splice site probably benign
IGL00495:Cacna2d1 APN 5 16370609 missense probably benign 0.05
IGL00538:Cacna2d1 APN 5 16246785 nonsense probably null
IGL00990:Cacna2d1 APN 5 15935069 missense probably benign 0.23
IGL01079:Cacna2d1 APN 5 16370648 missense probably benign 0.03
IGL01344:Cacna2d1 APN 5 16370631 missense probably benign 0.26
IGL01597:Cacna2d1 APN 5 16326392 splice site probably benign
IGL01645:Cacna2d1 APN 5 16012391 splice site probably null
IGL01959:Cacna2d1 APN 5 16212897 missense probably benign 0.00
IGL02397:Cacna2d1 APN 5 16320164 splice site probably benign
IGL03152:Cacna2d1 APN 5 16322568 missense probably benign 0.00
IGL03216:Cacna2d1 APN 5 16353842 missense probably damaging 0.98
IGL03374:Cacna2d1 APN 5 16356823 missense probably damaging 0.99
PIT4283001:Cacna2d1 UTSW 5 16302294 missense probably benign 0.31
PIT4585001:Cacna2d1 UTSW 5 16326344 missense probably damaging 1.00
R0158:Cacna2d1 UTSW 5 16361817 splice site probably benign
R0457:Cacna2d1 UTSW 5 16267416 missense probably damaging 1.00
R0477:Cacna2d1 UTSW 5 16194798 critical splice donor site probably null
R0483:Cacna2d1 UTSW 5 16359027 missense probably damaging 0.98
R0532:Cacna2d1 UTSW 5 16362273 missense probably benign 0.13
R0552:Cacna2d1 UTSW 5 16328043 missense probably damaging 1.00
R0924:Cacna2d1 UTSW 5 16365862 missense possibly damaging 0.79
R0930:Cacna2d1 UTSW 5 16365862 missense possibly damaging 0.79
R1144:Cacna2d1 UTSW 5 16322597 critical splice donor site probably null
R1164:Cacna2d1 UTSW 5 16361876 critical splice donor site probably null
R1398:Cacna2d1 UTSW 5 16357766 missense possibly damaging 0.47
R1440:Cacna2d1 UTSW 5 16355495 missense probably damaging 1.00
R1543:Cacna2d1 UTSW 5 16266718 missense possibly damaging 0.62
R1573:Cacna2d1 UTSW 5 16370627 missense probably damaging 1.00
R1633:Cacna2d1 UTSW 5 16320116 missense probably damaging 1.00
R1673:Cacna2d1 UTSW 5 16299990 missense probably damaging 1.00
R1750:Cacna2d1 UTSW 5 16264288 missense probably benign 0.01
R1753:Cacna2d1 UTSW 5 16302354 missense possibly damaging 0.95
R1966:Cacna2d1 UTSW 5 16333785 nonsense probably null
R2163:Cacna2d1 UTSW 5 16362319 missense probably damaging 1.00
R2258:Cacna2d1 UTSW 5 16357289 missense probably damaging 1.00
R2870:Cacna2d1 UTSW 5 16312568 missense probably damaging 1.00
R2870:Cacna2d1 UTSW 5 16312568 missense probably damaging 1.00
R4303:Cacna2d1 UTSW 5 16302248 splice site probably null
R4804:Cacna2d1 UTSW 5 16359208 missense probably damaging 0.97
R5032:Cacna2d1 UTSW 5 16359070 missense probably damaging 1.00
R5080:Cacna2d1 UTSW 5 16362396 critical splice donor site probably null
R5466:Cacna2d1 UTSW 5 16246714 missense probably damaging 1.00
R5469:Cacna2d1 UTSW 5 16352678 missense probably damaging 0.99
R5564:Cacna2d1 UTSW 5 16312519 missense probably damaging 1.00
R5655:Cacna2d1 UTSW 5 16302335 missense probably damaging 1.00
R5688:Cacna2d1 UTSW 5 16358952 missense probably damaging 0.99
R5729:Cacna2d1 UTSW 5 15935039 nonsense probably null
R6005:Cacna2d1 UTSW 5 16361821 missense probably damaging 1.00
R6343:Cacna2d1 UTSW 5 16322564 missense probably benign 0.09
R6485:Cacna2d1 UTSW 5 16354657 missense probably damaging 1.00
R6486:Cacna2d1 UTSW 5 16319450 splice site probably null
R6625:Cacna2d1 UTSW 5 16362393 missense probably null 1.00
R6700:Cacna2d1 UTSW 5 16365460 missense probably damaging 1.00
R6706:Cacna2d1 UTSW 5 16326340 missense probably damaging 1.00
R6711:Cacna2d1 UTSW 5 16300041 missense probably damaging 1.00
R7035:Cacna2d1 UTSW 5 16246672 missense probably damaging 1.00
R7086:Cacna2d1 UTSW 5 16349416 missense probably damaging 1.00
R7110:Cacna2d1 UTSW 5 16357784 missense probably damaging 0.99
R7268:Cacna2d1 UTSW 5 16370588 missense probably damaging 0.99
R7310:Cacna2d1 UTSW 5 16314916 missense probably damaging 1.00
R7471:Cacna2d1 UTSW 5 15934975 start gained probably benign
R7608:Cacna2d1 UTSW 5 16359024 missense probably damaging 1.00
R7712:Cacna2d1 UTSW 5 16362349 missense probably damaging 0.98
R8014:Cacna2d1 UTSW 5 16342691 missense possibly damaging 0.55
R8161:Cacna2d1 UTSW 5 16314937 missense probably damaging 1.00
RF024:Cacna2d1 UTSW 5 16025776 missense possibly damaging 0.80
Z1088:Cacna2d1 UTSW 5 16194763 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACATTTTCTCTTAGTACTGACTGGC -3'
(R):5'- TACTTACTACTGGGTTACACTCAC -3'

Sequencing Primer
(F):5'- TCATGTCCACAATAAGTAAGACAAG -3'
(R):5'- TACTGGGTTACACTCACAACTG -3'
Posted On2019-05-13