Incidental Mutation 'R7025:Gm15448'
ID545906
Institutional Source Beutler Lab
Gene Symbol Gm15448
Ensembl Gene ENSMUSG00000074419
Gene Namepredicted gene 15448
SynonymsENSMUSG00000074419
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock #R7025 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location3816781-3825687 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 3821262 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 629 (K629*)
Ref Sequence ENSEMBL: ENSMUSP00000140974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094911] [ENSMUST00000108619] [ENSMUST00000108620] [ENSMUST00000153846] [ENSMUST00000189095]
Predicted Effect probably benign
Transcript: ENSMUST00000094911
SMART Domains Protein: ENSMUSP00000092515
Gene: ENSMUSG00000074419

DomainStartEndE-ValueType
IG_like 40 105 3.26e0 SMART
IG 129 315 1.37e-1 SMART
IG_like 237 302 2.2e-1 SMART
IG 328 415 6.31e-1 SMART
IG 430 519 8.01e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108619
SMART Domains Protein: ENSMUSP00000104259
Gene: ENSMUSG00000074419

DomainStartEndE-ValueType
IG_like 40 105 3.26e0 SMART
IG 129 315 1.37e-1 SMART
IG_like 237 302 2.2e-1 SMART
IG 328 415 6.31e-1 SMART
IG_like 429 517 6.02e0 SMART
IG 529 618 8.01e-3 SMART
low complexity region 637 646 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108620
SMART Domains Protein: ENSMUSP00000104260
Gene: ENSMUSG00000074419

DomainStartEndE-ValueType
IG_like 40 105 3.26e0 SMART
IG 129 315 1.37e-1 SMART
IG_like 237 302 2.2e-1 SMART
IG 328 415 6.31e-1 SMART
IG 430 519 8.01e-3 SMART
low complexity region 538 547 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000153846
AA Change: K631*
SMART Domains Protein: ENSMUSP00000121707
Gene: ENSMUSG00000074419
AA Change: K631*

DomainStartEndE-ValueType
IG 7 96 8.01e-3 SMART
low complexity region 132 141 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000189095
AA Change: K629*
SMART Domains Protein: ENSMUSP00000140974
Gene: ENSMUSG00000074419
AA Change: K629*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG_like 40 105 1.3e-2 SMART
IG 129 315 5.7e-4 SMART
IG_like 237 302 9e-4 SMART
IG 328 415 2.6e-3 SMART
IG_like 429 517 2.4e-2 SMART
IG 529 618 3.3e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd4 T A 11: 103,104,538 L90M probably damaging Het
Acot7 T C 4: 152,178,189 S7P unknown Het
Ahcyl2 T C 6: 29,908,421 Y388H probably damaging Het
Atp1a2 T A 1: 172,284,550 R593* probably null Het
Bicral T C 17: 46,801,668 T869A probably benign Het
Brca2 C T 5: 150,540,478 P1236S probably benign Het
Cacna2d1 C T 5: 16,352,668 Q699* probably null Het
Ccser2 T C 14: 36,940,007 N407D probably damaging Het
Cd300lg A G 11: 102,043,074 Y49C probably damaging Het
Cdh12 C A 15: 21,358,814 T108K probably damaging Het
Ctnnd1 A T 2: 84,610,606 I715K possibly damaging Het
Cyp17a1 T A 19: 46,670,980 D137V probably damaging Het
Dbr1 A G 9: 99,575,983 T19A probably damaging Het
Dnah3 C T 7: 120,030,010 A1441T possibly damaging Het
Dpt G A 1: 164,796,939 D70N probably damaging Het
Elk4 C A 1: 132,019,369 P366Q probably damaging Het
Eml4 A C 17: 83,425,311 D131A probably benign Het
Faap24 A G 7: 35,392,871 I207T possibly damaging Het
Fam198b T C 3: 79,886,548 Y108H probably damaging Het
Fam219a T C 4: 41,521,925 S41G probably benign Het
Ifi203 T C 1: 173,928,385 probably benign Het
Inpp4a T C 1: 37,369,423 V295A probably benign Het
Kif2a A G 13: 106,982,594 Y267H probably damaging Het
Kprp T A 3: 92,825,197 Q182L probably benign Het
Krt90 T C 15: 101,557,175 K337R possibly damaging Het
Lrp2 T A 2: 69,483,028 Y2453F possibly damaging Het
Magel2 A C 7: 62,379,787 Y813S unknown Het
Myh7 C A 14: 54,974,644 E1548* probably null Het
Myh8 A G 11: 67,297,539 T1009A probably benign Het
Nab2 T A 10: 127,666,508 probably benign Het
Neb T C 2: 52,296,273 D929G possibly damaging Het
Nelfb A C 2: 25,210,493 V155G probably damaging Het
Nmur1 C A 1: 86,387,848 M65I possibly damaging Het
Nop56 C T 2: 130,277,881 R81* probably null Het
Npnt C T 3: 132,908,396 C47Y probably damaging Het
Nrp1 G T 8: 128,480,954 C610F probably damaging Het
Olfr1175-ps T C 2: 88,323,262 K148E probably damaging Het
Olfr1243 T A 2: 89,527,604 I269F probably damaging Het
Olfr766-ps1 T A 10: 129,064,675 M1L probably benign Het
Pax5 G A 4: 44,679,501 Q93* probably null Het
Pcnt G T 10: 76,403,835 Q1273K probably damaging Het
Pde4dip G A 3: 97,724,183 Q1137* probably null Het
Pfas A T 11: 68,990,760 D959E probably benign Het
Prex1 TCCGACCCC TCCGACCCCGACCCC 2: 166,613,187 probably benign Het
Prpf40b C T 15: 99,306,400 Q182* probably null Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rpe65 A C 3: 159,622,685 E406A probably damaging Het
Serpina3k A T 12: 104,341,142 Y211F probably benign Het
Shkbp1 T C 7: 27,355,281 I65V possibly damaging Het
Slc22a29 G A 19: 8,160,580 P544S probably benign Het
Stab2 T C 10: 86,850,837 D2281G probably damaging Het
Tjp2 A G 19: 24,132,688 M64T probably benign Het
Tnfrsf8 C T 4: 145,274,403 V378I possibly damaging Het
Trpm1 A T 7: 64,226,714 probably null Het
Ubqln3 A G 7: 104,141,275 I536T probably benign Het
Vmn1r44 A G 6: 89,893,754 T161A possibly damaging Het
Vmn2r108 T A 17: 20,471,083 I393F possibly damaging Het
Other mutations in Gm15448
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Gm15448 APN 7 3823089 missense probably damaging 1.00
IGL01675:Gm15448 APN 7 3822608 splice site probably benign
IGL02040:Gm15448 APN 7 3821517 splice site probably benign
IGL02547:Gm15448 APN 7 3821661 missense probably damaging 0.98
IGL02749:Gm15448 APN 7 3822625 missense probably damaging 1.00
IGL02822:Gm15448 APN 7 3816918 missense possibly damaging 0.50
IGL02883:Gm15448 APN 7 3822180 missense possibly damaging 0.95
IGL03140:Gm15448 APN 7 3823248 missense probably benign 0.00
IGL03185:Gm15448 APN 7 3823230 missense probably damaging 1.00
IGL03212:Gm15448 APN 7 3823133 missense probably benign 0.00
R0347:Gm15448 UTSW 7 3822874 missense probably damaging 1.00
R0652:Gm15448 UTSW 7 3822763 missense probably benign 0.02
R0668:Gm15448 UTSW 7 3822700 missense probably damaging 0.99
R0724:Gm15448 UTSW 7 3816872 missense possibly damaging 0.83
R0735:Gm15448 UTSW 7 3821782 missense possibly damaging 0.79
R1074:Gm15448 UTSW 7 3823070 missense probably damaging 1.00
R1339:Gm15448 UTSW 7 3822156 missense probably damaging 1.00
R1541:Gm15448 UTSW 7 3816989 missense probably damaging 1.00
R1570:Gm15448 UTSW 7 3823061 missense probably benign 0.45
R1880:Gm15448 UTSW 7 3824951 critical splice donor site probably null
R1892:Gm15448 UTSW 7 3824574 missense probably benign 0.15
R1909:Gm15448 UTSW 7 3822919 missense probably benign 0.31
R2881:Gm15448 UTSW 7 3825641 start codon destroyed probably null 0.98
R2967:Gm15448 UTSW 7 3822687 missense probably damaging 1.00
R2983:Gm15448 UTSW 7 3821575 missense probably damaging 1.00
R4213:Gm15448 UTSW 7 3821554 missense probably damaging 1.00
R4319:Gm15448 UTSW 7 3822755 missense possibly damaging 0.46
R4320:Gm15448 UTSW 7 3822755 missense possibly damaging 0.46
R4321:Gm15448 UTSW 7 3822755 missense possibly damaging 0.46
R4322:Gm15448 UTSW 7 3822755 missense possibly damaging 0.46
R4323:Gm15448 UTSW 7 3822755 missense possibly damaging 0.46
R4536:Gm15448 UTSW 7 3822252 missense probably benign 0.00
R4597:Gm15448 UTSW 7 3822155 missense possibly damaging 0.81
R4713:Gm15448 UTSW 7 3822681 nonsense probably null
R4725:Gm15448 UTSW 7 3821548 missense probably benign
R4934:Gm15448 UTSW 7 3822677 missense probably damaging 1.00
R4971:Gm15448 UTSW 7 3822806 missense probably benign 0.00
R5138:Gm15448 UTSW 7 3824557 nonsense probably null
R5805:Gm15448 UTSW 7 3822623 missense probably benign 0.15
R5824:Gm15448 UTSW 7 3824754 missense probably damaging 1.00
R5841:Gm15448 UTSW 7 3822899 nonsense probably null
R6027:Gm15448 UTSW 7 3824639 missense possibly damaging 0.94
R6214:Gm15448 UTSW 7 3821718 missense probably damaging 0.99
R6329:Gm15448 UTSW 7 3822851 missense probably damaging 1.00
R6429:Gm15448 UTSW 7 3822346 missense possibly damaging 0.63
R6650:Gm15448 UTSW 7 3816899 missense possibly damaging 0.83
R6681:Gm15448 UTSW 7 3822252 missense probably benign 0.00
R6961:Gm15448 UTSW 7 3825125 missense probably damaging 1.00
R6989:Gm15448 UTSW 7 3822164 missense possibly damaging 0.95
R7071:Gm15448 UTSW 7 3821668 missense unknown
R7194:Gm15448 UTSW 7 3824793 missense
R7215:Gm15448 UTSW 7 3822311 missense unknown
R7580:Gm15448 UTSW 7 3824612 missense unknown
R7776:Gm15448 UTSW 7 3823247 missense unknown
R7863:Gm15448 UTSW 7 3824802 critical splice acceptor site probably null
R7909:Gm15448 UTSW 7 3821709 missense unknown
R8131:Gm15448 UTSW 7 3822162 nonsense probably null
R8178:Gm15448 UTSW 7 3821261 missense unknown
R8188:Gm15448 UTSW 7 3823127 missense unknown
R8220:Gm15448 UTSW 7 3822904 missense unknown
R8226:Gm15448 UTSW 7 3825110 missense
R8441:Gm15448 UTSW 7 3823302 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCAAGTGGAGGCTCAATGC -3'
(R):5'- GGACATAAGGCACATTCCTGAG -3'

Sequencing Primer
(F):5'- TTCTGTAGCCCAACAGTTAAGC -3'
(R):5'- GGCACATTCCTGAGCAAATAACTGG -3'
Posted On2019-05-13