Incidental Mutation 'R7025:Faap24'
ID545908
Institutional Source Beutler Lab
Gene Symbol Faap24
Ensembl Gene ENSMUSG00000030493
Gene NameFanconi anemia core complex associated protein 24
SynonymsC230052I12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.199) question?
Stock #R7025 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location35392152-35396836 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35392871 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 207 (I207T)
Ref Sequence ENSEMBL: ENSMUSP00000115766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032704] [ENSMUST00000032705] [ENSMUST00000079414] [ENSMUST00000085556] [ENSMUST00000141704] [ENSMUST00000154597] [ENSMUST00000206854]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032704
AA Change: I207T

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000032704
Gene: ENSMUSG00000030493
AA Change: I207T

DomainStartEndE-ValueType
Pfam:HHH_2 162 219 1.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000032705
SMART Domains Protein: ENSMUSP00000032705
Gene: ENSMUSG00000030494

DomainStartEndE-ValueType
Hr1 38 101 2.42e-12 SMART
BRO1 111 513 1.27e-167 SMART
PDZ 524 594 1.73e-9 SMART
low complexity region 623 637 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079414
SMART Domains Protein: ENSMUSP00000078383
Gene: ENSMUSG00000023072

DomainStartEndE-ValueType
low complexity region 27 62 N/A INTRINSIC
low complexity region 181 190 N/A INTRINSIC
coiled coil region 252 291 N/A INTRINSIC
coiled coil region 372 598 N/A INTRINSIC
coiled coil region 670 732 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085556
SMART Domains Protein: ENSMUSP00000082692
Gene: ENSMUSG00000030494

DomainStartEndE-ValueType
Hr1 38 101 2.42e-12 SMART
BRO1 111 513 1.27e-167 SMART
PDZ 524 594 1.73e-9 SMART
low complexity region 623 637 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141704
SMART Domains Protein: ENSMUSP00000121393
Gene: ENSMUSG00000023072

DomainStartEndE-ValueType
low complexity region 27 62 N/A INTRINSIC
low complexity region 181 190 N/A INTRINSIC
coiled coil region 252 291 N/A INTRINSIC
coiled coil region 372 598 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000154597
AA Change: I207T

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115766
Gene: ENSMUSG00000030493
AA Change: I207T

DomainStartEndE-ValueType
Pfam:HHH_2 162 219 2.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206854
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] FAAP24 is a component of the Fanconi anemia (FA) core complex (see MIM 227650), which plays a crucial role in DNA damage response (Ciccia et al., 2007 [PubMed 17289582]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd4 T A 11: 103,104,538 L90M probably damaging Het
Acot7 T C 4: 152,178,189 S7P unknown Het
Ahcyl2 T C 6: 29,908,421 Y388H probably damaging Het
Atp1a2 T A 1: 172,284,550 R593* probably null Het
Bicral T C 17: 46,801,668 T869A probably benign Het
Brca2 C T 5: 150,540,478 P1236S probably benign Het
Cacna2d1 C T 5: 16,352,668 Q699* probably null Het
Ccser2 T C 14: 36,940,007 N407D probably damaging Het
Cd300lg A G 11: 102,043,074 Y49C probably damaging Het
Cdh12 C A 15: 21,358,814 T108K probably damaging Het
Ctnnd1 A T 2: 84,610,606 I715K possibly damaging Het
Cyp17a1 T A 19: 46,670,980 D137V probably damaging Het
Dbr1 A G 9: 99,575,983 T19A probably damaging Het
Dnah3 C T 7: 120,030,010 A1441T possibly damaging Het
Dpt G A 1: 164,796,939 D70N probably damaging Het
Elk4 C A 1: 132,019,369 P366Q probably damaging Het
Eml4 A C 17: 83,425,311 D131A probably benign Het
Fam198b T C 3: 79,886,548 Y108H probably damaging Het
Fam219a T C 4: 41,521,925 S41G probably benign Het
Gm15448 T A 7: 3,821,262 K629* probably null Het
Ifi203 T C 1: 173,928,385 probably benign Het
Inpp4a T C 1: 37,369,423 V295A probably benign Het
Kif2a A G 13: 106,982,594 Y267H probably damaging Het
Kprp T A 3: 92,825,197 Q182L probably benign Het
Krt90 T C 15: 101,557,175 K337R possibly damaging Het
Lrp2 T A 2: 69,483,028 Y2453F possibly damaging Het
Magel2 A C 7: 62,379,787 Y813S unknown Het
Myh7 C A 14: 54,974,644 E1548* probably null Het
Myh8 A G 11: 67,297,539 T1009A probably benign Het
Nab2 T A 10: 127,666,508 probably benign Het
Neb T C 2: 52,296,273 D929G possibly damaging Het
Nelfb A C 2: 25,210,493 V155G probably damaging Het
Nmur1 C A 1: 86,387,848 M65I possibly damaging Het
Nop56 C T 2: 130,277,881 R81* probably null Het
Npnt C T 3: 132,908,396 C47Y probably damaging Het
Nrp1 G T 8: 128,480,954 C610F probably damaging Het
Olfr1175-ps T C 2: 88,323,262 K148E probably damaging Het
Olfr1243 T A 2: 89,527,604 I269F probably damaging Het
Olfr766-ps1 T A 10: 129,064,675 M1L probably benign Het
Pax5 G A 4: 44,679,501 Q93* probably null Het
Pcnt G T 10: 76,403,835 Q1273K probably damaging Het
Pde4dip G A 3: 97,724,183 Q1137* probably null Het
Pfas A T 11: 68,990,760 D959E probably benign Het
Prex1 TCCGACCCC TCCGACCCCGACCCC 2: 166,613,187 probably benign Het
Prpf40b C T 15: 99,306,400 Q182* probably null Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rpe65 A C 3: 159,622,685 E406A probably damaging Het
Serpina3k A T 12: 104,341,142 Y211F probably benign Het
Shkbp1 T C 7: 27,355,281 I65V possibly damaging Het
Slc22a29 G A 19: 8,160,580 P544S probably benign Het
Stab2 T C 10: 86,850,837 D2281G probably damaging Het
Tjp2 A G 19: 24,132,688 M64T probably benign Het
Tnfrsf8 C T 4: 145,274,403 V378I possibly damaging Het
Trpm1 A T 7: 64,226,714 probably null Het
Ubqln3 A G 7: 104,141,275 I536T probably benign Het
Vmn1r44 A G 6: 89,893,754 T161A possibly damaging Het
Vmn2r108 T A 17: 20,471,083 I393F possibly damaging Het
Other mutations in Faap24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02265:Faap24 APN 7 35396264 missense probably benign 0.01
IGL02951:Faap24 APN 7 35392951 missense probably damaging 0.98
IGL03351:Faap24 APN 7 35395309 nonsense probably null
R0030:Faap24 UTSW 7 35392860 missense probably damaging 0.97
R0606:Faap24 UTSW 7 35394963 unclassified probably benign
R1378:Faap24 UTSW 7 35392901 missense probably benign 0.06
R3749:Faap24 UTSW 7 35393012 missense possibly damaging 0.94
R4661:Faap24 UTSW 7 35395084 missense probably benign 0.00
R6279:Faap24 UTSW 7 35396284 missense possibly damaging 0.90
R7074:Faap24 UTSW 7 35395102 missense possibly damaging 0.92
R7171:Faap24 UTSW 7 35392854 nonsense probably null
R7249:Faap24 UTSW 7 35395060 missense probably benign
R7566:Faap24 UTSW 7 35393040 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTTAGCAGAAAGTGGCCAGTG -3'
(R):5'- AAAAGCGCTCCATGCTCTCC -3'

Sequencing Primer
(F):5'- TGGCTGCCCAGACAGACAC -3'
(R):5'- CGAGCTCTCCCTTGTTCAAACAG -3'
Posted On2019-05-13