Mutagenetix > Incidental Mutation

Incidental Mutation 'R0610:Ino80'

54591

Institutional Source

Beutler Lab

Gene Symbol

Ino80

Ensembl Gene

ENSMUSG00000034154

Gene Name

INO80 complex subunit

Synonyms

INO80, 2310079N15Rik, 4632409L19Rik, Inoc1

MMRRC Submission

038799-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.960) question?

Stock #

R0610 (G1)

Quality Score

176

Status

Validated

Chromosome

Chromosomal Location

119373042-119477687 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 119382960 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 1249 (R1249C)

Ref Sequence

ENSEMBL: ENSMUSP00000051845 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049920]

AlphaFold

Q6ZPV2

Predicted Effect

probably damaging
Transcript: ENSMUST00000049920
AA Change: R1249C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000051845
Gene: ENSMUSG00000034154
AA Change: R1249C

Domain	Start	End	E-Value	Type
coiled coil region	131	165	N/A	INTRINSIC
low complexity region	206	242	N/A	INTRINSIC
Pfam:DBINO	275	407	6.6e-50	PFAM
low complexity region	474	489	N/A	INTRINSIC
DEXDc	516	714	6.27e-37	SMART
low complexity region	907	923	N/A	INTRINSIC
HELICc	1134	1217	2.86e-22	SMART
low complexity region	1270	1324	N/A	INTRINSIC
low complexity region	1357	1368	N/A	INTRINSIC
low complexity region	1424	1436	N/A	INTRINSIC
low complexity region	1438	1450	N/A	INTRINSIC
low complexity region	1457	1483	N/A	INTRINSIC
low complexity region	1510	1521	N/A	INTRINSIC

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.4%
20x: 94.7%

Validation Efficiency

99% (97/98)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the chromatin remodeling complex, which is classified into subfamilies depending on sequence features apart from the conserved ATPase domain. This protein is the catalytic ATPase subunit of the INO80 chromatin remodeling complex, which is characterized by a DNA-binding domain. This protein is proposed to bind DNA and be recruited by the YY1 transcription factor to activate certain genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Embryos homozygous for a knock-out allele die around E7.5 and show absence of anterior and distal visceral endoderm. Another null allele results in embryonic lethality by E13.5-E14.5 with severe growth retardation and developmental defects. Heterozygotes show defects in hindlimb extension reflex. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	A	T	7: 40,993,056	T141S	probably benign	Het
4930578I06Rik	G	A	14: 63,986,265	R21*	probably null	Het
9530003J23Rik	A	G	10: 117,237,730	F66S	probably benign	Het
Abca15	A	G	7: 120,365,786	E757G	possibly damaging	Het
Abca5	T	C	11: 110,301,527	T720A	probably benign	Het
Actr5	T	A	2: 158,632,456		probably null	Het
Adgrl3	T	C	5: 81,693,716		probably benign	Het
Adra1a	A	G	14: 66,637,792	D72G	probably damaging	Het
Ahnak	G	T	19: 9,007,878	L2175F	probably benign	Het
AK157302	A	G	13: 21,495,663	T120A	possibly damaging	Het
Apol7a	G	A	15: 77,389,254	A336V	probably benign	Het
Asic1	C	A	15: 99,698,899	H525Q	probably benign	Het
Atxn7l2	T	C	3: 108,204,774	D335G	possibly damaging	Het
Bpgm	G	T	6: 34,504,349	R227L	possibly damaging	Het
Calm4	T	A	13: 3,838,320	V142E	possibly damaging	Het
Catsperg1	A	T	7: 29,190,619	L721Q	probably damaging	Het
Cdh26	A	G	2: 178,449,898	I83M	probably damaging	Het
Cep295	A	C	9: 15,322,754	S2249A	possibly damaging	Het
Cln3	A	G	7: 126,580,189	F139L	probably damaging	Het
Cmpk2	T	A	12: 26,478,056	L424Q	possibly damaging	Het
Col12a1	A	T	9: 79,707,848	V53E	probably benign	Het
Csmd1	G	A	8: 15,918,208	R3140C	possibly damaging	Het
Dagla	A	G	19: 10,271,558	W11R	probably damaging	Het
Dbx2	C	T	15: 95,624,897	V310M	probably benign	Het
Disp2	T	A	2: 118,792,236	C1150S	probably benign	Het
Dock3	T	C	9: 107,023,788	D326G	probably damaging	Het
Dph1	G	T	11: 75,185,957		probably benign	Het
Dyrk1b	C	A	7: 28,186,634	T594K	probably damaging	Het
Evx2	C	A	2: 74,655,987	A353S	probably benign	Het
Fam71f1	T	A	6: 29,326,577	V231E	probably benign	Het
Gm4737	T	C	16: 46,153,901	E371G	probably damaging	Het
Gm4788	G	A	1: 139,701,846	T799I	probably benign	Het
Greb1	A	C	12: 16,696,442	S1276A	probably benign	Het
Hhipl1	T	A	12: 108,319,402	C490*	probably null	Het
Hmmr	G	T	11: 40,715,902	T231K	probably damaging	Het
Hspa4l	A	C	3: 40,779,400	E526D	probably benign	Het
Ibsp	A	G	5: 104,310,134	E179G	probably benign	Het
Ift140	C	T	17: 25,035,803	A150V	probably benign	Het
Igf2bp2	A	G	16: 22,070,309	S416P	probably benign	Het
Ighe	T	C	12: 113,271,743	K294E	unknown	Het
Iqca	C	A	1: 90,142,731	G133V	probably null	Het
Kng2	T	A	16: 23,000,594	N231Y	possibly damaging	Het
Lca5	A	T	9: 83,399,739	C331S	probably benign	Het
Lrrc1	A	G	9: 77,472,206	I101T	possibly damaging	Het
Lrrk2	A	T	15: 91,815,416	I2489L	probably benign	Het
Mapk9	A	C	11: 49,863,573	N51T	probably benign	Het
Marf1	C	T	16: 14,142,534	A549T	probably damaging	Het
Nek2	T	A	1: 191,822,515	V113D	probably damaging	Het
Nr4a3	C	A	4: 48,051,903	A248E	probably benign	Het
Nrp1	T	C	8: 128,502,618	I859T	probably damaging	Het
Olfm5	A	T	7: 104,154,445	Y195*	probably null	Het
Olfr354	T	A	2: 36,907,659	W238R	probably damaging	Het
Olfr71	T	A	4: 43,706,400	H56L	possibly damaging	Het
Olfr955	A	G	9: 39,469,823	L301P	probably damaging	Het
Oxtr	C	T	6: 112,477,177	R42Q	probably benign	Het
Pcnx2	A	G	8: 125,839,687	W1006R	probably damaging	Het
Pdpk1	T	C	17: 24,098,171		probably null	Het
Ryr2	T	A	13: 11,622,952	H3731L	probably damaging	Het
Sdr16c5	T	G	4: 4,016,116	E103D	possibly damaging	Het
Setdb2	A	C	14: 59,417,470	S324A	possibly damaging	Het
Slc17a3	C	T	13: 23,855,858	S293F	probably damaging	Het
Slc17a8	A	T	10: 89,576,626	I499K	probably damaging	Het
Slc2a9	T	A	5: 38,379,942	I389F	probably damaging	Het
Slc30a1	T	C	1: 191,909,424	V394A	probably damaging	Het
Slc41a2	A	G	10: 83,283,728	I390T	possibly damaging	Het
Slco1a1	A	G	6: 141,918,461		probably null	Het
Slit2	A	G	5: 48,275,674	K1053E	possibly damaging	Het
Smarca2	T	A	19: 26,691,391	L930Q	probably damaging	Het
Snx6	T	C	12: 54,751,789	H387R	probably damaging	Het
Sox5	A	T	6: 143,833,439	M622K	possibly damaging	Het
Ston1	C	A	17: 88,635,281	N38K	possibly damaging	Het
Strbp	C	T	2: 37,584,077	V658I	probably damaging	Het
Strn3	T	C	12: 51,610,448		probably null	Het
Suco	T	G	1: 161,859,503	D96A	probably benign	Het
Suco	A	G	1: 161,864,032		probably benign	Het
Sytl2	A	T	7: 90,380,853		probably benign	Het
Tmem41b	T	A	7: 109,981,083	M25L	probably benign	Het
Tmem41b	T	A	7: 109,981,085	D91V	probably damaging	Het
Tmem50b	C	T	16: 91,583,286	A68T	probably damaging	Het
Tmprss11e	G	A	5: 86,707,347	Q400*	probably null	Het
Tnfsf13b	G	A	8: 10,031,661		probably null	Het
Trappc8	A	G	18: 20,837,188	V916A	probably damaging	Het
Trdn	G	T	10: 33,474,453	V673F	probably damaging	Het
Trim28	G	T	7: 13,025,784		probably benign	Het
Txnrd2	T	C	16: 18,472,882	V427A	probably damaging	Het
Uggt1	T	C	1: 36,165,506		probably benign	Het
Vmn1r36	A	G	6: 66,716,420	L51P	probably damaging	Het
Vmn1r63	T	A	7: 5,803,064	M190L	possibly damaging	Het
Vmn2r116	T	A	17: 23,387,312	N399K	probably damaging	Het
Vmn2r117	T	C	17: 23,475,514	N453S	probably benign	Het
Wbp1l	T	A	19: 46,654,670	I370N	probably damaging	Het
Zfp445	T	C	9: 122,852,981	K632E	probably benign	Het
Zfp850	C	T	7: 27,989,394	R463H	probably damaging	Het
Zyg11a	A	G	4: 108,204,857	L249P	probably damaging	Het

Other mutations in Ino80

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01402:Ino80	APN	2	119456718	missense	possibly damaging	0.83
IGL01404:Ino80	APN	2	119456718	missense	possibly damaging	0.83
IGL01985:Ino80	APN	2	119433321	missense	probably damaging	0.99
IGL02039:Ino80	APN	2	119380073	missense	probably damaging	1.00
IGL02187:Ino80	APN	2	119445457	splice site	probably benign
IGL02726:Ino80	APN	2	119442483	missense	probably damaging	1.00
Chosen	UTSW	2	119382269	splice site	probably null
PIT4677001:Ino80	UTSW	2	119377545	missense	probably benign
R0004:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0004:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0057:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0113:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0114:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0115:Ino80	UTSW	2	119431016	missense	probably damaging	1.00
R0138:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0189:Ino80	UTSW	2	119379679	missense	probably benign	0.36
R0363:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0364:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0365:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0481:Ino80	UTSW	2	119431016	missense	probably damaging	1.00
R0532:Ino80	UTSW	2	119381983	missense	possibly damaging	0.79
R0580:Ino80	UTSW	2	119383481	missense	probably damaging	1.00
R0675:Ino80	UTSW	2	119383481	missense	probably damaging	1.00
R1275:Ino80	UTSW	2	119427055	missense	probably benign	0.12
R1470:Ino80	UTSW	2	119379649	missense	probably damaging	1.00
R1470:Ino80	UTSW	2	119379649	missense	probably damaging	1.00
R1506:Ino80	UTSW	2	119425265	nonsense	probably null
R1510:Ino80	UTSW	2	119450049	missense	probably damaging	1.00
R1570:Ino80	UTSW	2	119447028	missense	possibly damaging	0.68
R1613:Ino80	UTSW	2	119392867	missense	probably damaging	1.00
R1673:Ino80	UTSW	2	119381936	missense	probably damaging	1.00
R1773:Ino80	UTSW	2	119418409	missense	probably benign	0.18
R1795:Ino80	UTSW	2	119406859	missense	probably damaging	1.00
R2093:Ino80	UTSW	2	119426670	missense	possibly damaging	0.55
R2105:Ino80	UTSW	2	119431929	missense	probably null	1.00
R2113:Ino80	UTSW	2	119454084	missense	probably damaging	1.00
R3618:Ino80	UTSW	2	119446872	missense	probably null	0.81
R4572:Ino80	UTSW	2	119402358	missense	probably damaging	1.00
R4649:Ino80	UTSW	2	119431008	missense	probably damaging	1.00
R4919:Ino80	UTSW	2	119442592	missense	probably damaging	1.00
R5113:Ino80	UTSW	2	119431945	missense	probably damaging	1.00
R5138:Ino80	UTSW	2	119383421	missense	probably damaging	1.00
R5458:Ino80	UTSW	2	119412429	missense	possibly damaging	0.50
R5499:Ino80	UTSW	2	119441647	missense	probably damaging	1.00
R5502:Ino80	UTSW	2	119402396	missense	probably damaging	1.00
R5531:Ino80	UTSW	2	119445575	missense	probably benign
R5740:Ino80	UTSW	2	119431029	missense	probably damaging	1.00
R5892:Ino80	UTSW	2	119439547	intron	probably benign
R5914:Ino80	UTSW	2	119458216	missense	probably damaging	0.99
R6000:Ino80	UTSW	2	119374508	missense	probably benign	0.04
R6263:Ino80	UTSW	2	119383414	missense	probably damaging	1.00
R6505:Ino80	UTSW	2	119451441	missense	probably damaging	1.00
R6942:Ino80	UTSW	2	119383502	missense	probably damaging	0.99
R7052:Ino80	UTSW	2	119426587	critical splice donor site	probably null
R7100:Ino80	UTSW	2	119374513	missense	possibly damaging	0.47
R7163:Ino80	UTSW	2	119392875	missense	probably damaging	1.00
R7187:Ino80	UTSW	2	119426591	missense	probably benign	0.00
R7202:Ino80	UTSW	2	119374437	missense	probably benign	0.00
R7218:Ino80	UTSW	2	119458127	missense	probably benign
R7389:Ino80	UTSW	2	119442529	missense	probably benign	0.00
R7419:Ino80	UTSW	2	119380014	missense	probably benign	0.00
R7437:Ino80	UTSW	2	119442586	missense	possibly damaging	0.86
R7607:Ino80	UTSW	2	119382269	splice site	probably null
R7702:Ino80	UTSW	2	119442573	missense	probably benign	0.01
R7975:Ino80	UTSW	2	119456467	splice site	probably null
R7978:Ino80	UTSW	2	119439393	missense	possibly damaging	0.93
R8376:Ino80	UTSW	2	119442487	missense	probably benign	0.14
R8469:Ino80	UTSW	2	119379593	missense	probably benign
R8720:Ino80	UTSW	2	119402387	missense	probably damaging	1.00
R8751:Ino80	UTSW	2	119406908	missense	probably benign
R8958:Ino80	UTSW	2	119383381	missense	probably damaging	1.00
R8992:Ino80	UTSW	2	119379578	missense	possibly damaging	0.93
R9319:Ino80	UTSW	2	119374524	missense	probably benign	0.13
R9346:Ino80	UTSW	2	119426958	missense	possibly damaging	0.54
R9370:Ino80	UTSW	2	119402367	missense	probably damaging	1.00
R9621:Ino80	UTSW	2	119450015	missense	probably damaging	0.98
R9641:Ino80	UTSW	2	119445484	missense	probably benign	0.08
R9650:Ino80	UTSW	2	119446983	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTCACAGGAACTCAGGGTAAATCTGAA -3'
(R):5'- ACACTGATACCAGGAAGGGTGACAT -3'

Sequencing Primer
(F):5'- cacacacacacacacactc -3'
(R):5'- GACATTTCAGAGTTCACCTTGG -3'

Posted On

2013-07-11