Incidental Mutation 'R7025:Ubqln3'
ID545911
Institutional Source Beutler Lab
Gene Symbol Ubqln3
Ensembl Gene ENSMUSG00000051618
Gene Nameubiquilin 3
Synonyms4933400K24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R7025 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location104140623-104143279 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104141275 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 536 (I536T)
Ref Sequence ENSEMBL: ENSMUSP00000055229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057254] [ENSMUST00000138055]
Predicted Effect probably benign
Transcript: ENSMUST00000057254
AA Change: I536T

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000055229
Gene: ENSMUSG00000051618
AA Change: I536T

DomainStartEndE-ValueType
UBQ 22 92 1.56e-15 SMART
low complexity region 103 115 N/A INTRINSIC
low complexity region 120 151 N/A INTRINSIC
STI1 194 233 4.25e-7 SMART
low complexity region 280 291 N/A INTRINSIC
low complexity region 313 328 N/A INTRINSIC
low complexity region 505 515 N/A INTRINSIC
UBA 619 657 4.22e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-like protein (ubiquilin) that shares a high degree of similarity with related products in yeast, rat and frog. Ubiquilins contain an N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases, and are thus thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This gene is specifically expressed in the testis. It has been suggested that this gene may regulate cell-cycle progression during spermatogenesis, however, it has been shown that the ortholgous mouse gene is dispensable for embryonic development and spermatogenesis. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and developmentally normal with no apparent defects in male fertility or spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd4 T A 11: 103,104,538 L90M probably damaging Het
Acot7 T C 4: 152,178,189 S7P unknown Het
Ahcyl2 T C 6: 29,908,421 Y388H probably damaging Het
Atp1a2 T A 1: 172,284,550 R593* probably null Het
Bicral T C 17: 46,801,668 T869A probably benign Het
Brca2 C T 5: 150,540,478 P1236S probably benign Het
Cacna2d1 C T 5: 16,352,668 Q699* probably null Het
Ccser2 T C 14: 36,940,007 N407D probably damaging Het
Cd300lg A G 11: 102,043,074 Y49C probably damaging Het
Cdh12 C A 15: 21,358,814 T108K probably damaging Het
Ctnnd1 A T 2: 84,610,606 I715K possibly damaging Het
Cyp17a1 T A 19: 46,670,980 D137V probably damaging Het
Dbr1 A G 9: 99,575,983 T19A probably damaging Het
Dnah3 C T 7: 120,030,010 A1441T possibly damaging Het
Dpt G A 1: 164,796,939 D70N probably damaging Het
Elk4 C A 1: 132,019,369 P366Q probably damaging Het
Eml4 A C 17: 83,425,311 D131A probably benign Het
Faap24 A G 7: 35,392,871 I207T possibly damaging Het
Fam198b T C 3: 79,886,548 Y108H probably damaging Het
Fam219a T C 4: 41,521,925 S41G probably benign Het
Gm15448 T A 7: 3,821,262 K629* probably null Het
Ifi203 T C 1: 173,928,385 probably benign Het
Inpp4a T C 1: 37,369,423 V295A probably benign Het
Kif2a A G 13: 106,982,594 Y267H probably damaging Het
Kprp T A 3: 92,825,197 Q182L probably benign Het
Krt90 T C 15: 101,557,175 K337R possibly damaging Het
Lrp2 T A 2: 69,483,028 Y2453F possibly damaging Het
Magel2 A C 7: 62,379,787 Y813S unknown Het
Myh7 C A 14: 54,974,644 E1548* probably null Het
Myh8 A G 11: 67,297,539 T1009A probably benign Het
Nab2 T A 10: 127,666,508 probably benign Het
Neb T C 2: 52,296,273 D929G possibly damaging Het
Nelfb A C 2: 25,210,493 V155G probably damaging Het
Nmur1 C A 1: 86,387,848 M65I possibly damaging Het
Nop56 C T 2: 130,277,881 R81* probably null Het
Npnt C T 3: 132,908,396 C47Y probably damaging Het
Nrp1 G T 8: 128,480,954 C610F probably damaging Het
Olfr1175-ps T C 2: 88,323,262 K148E probably damaging Het
Olfr1243 T A 2: 89,527,604 I269F probably damaging Het
Olfr766-ps1 T A 10: 129,064,675 M1L probably benign Het
Pax5 G A 4: 44,679,501 Q93* probably null Het
Pcnt G T 10: 76,403,835 Q1273K probably damaging Het
Pde4dip G A 3: 97,724,183 Q1137* probably null Het
Pfas A T 11: 68,990,760 D959E probably benign Het
Prex1 TCCGACCCC TCCGACCCCGACCCC 2: 166,613,187 probably benign Het
Prpf40b C T 15: 99,306,400 Q182* probably null Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rpe65 A C 3: 159,622,685 E406A probably damaging Het
Serpina3k A T 12: 104,341,142 Y211F probably benign Het
Shkbp1 T C 7: 27,355,281 I65V possibly damaging Het
Slc22a29 G A 19: 8,160,580 P544S probably benign Het
Stab2 T C 10: 86,850,837 D2281G probably damaging Het
Tjp2 A G 19: 24,132,688 M64T probably benign Het
Tnfrsf8 C T 4: 145,274,403 V378I possibly damaging Het
Trpm1 A T 7: 64,226,714 probably null Het
Vmn1r44 A G 6: 89,893,754 T161A possibly damaging Het
Vmn2r108 T A 17: 20,471,083 I393F possibly damaging Het
Other mutations in Ubqln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Ubqln3 APN 7 104141777 missense probably benign 0.00
IGL00766:Ubqln3 APN 7 104142824 missense probably benign 0.00
IGL01451:Ubqln3 APN 7 104142196 missense possibly damaging 0.71
IGL01673:Ubqln3 APN 7 104142398 missense probably benign 0.12
IGL01705:Ubqln3 APN 7 104142677 missense probably damaging 1.00
IGL01988:Ubqln3 APN 7 104142882 utr 5 prime probably benign
IGL02008:Ubqln3 APN 7 104142316 missense probably damaging 1.00
IGL02072:Ubqln3 APN 7 104141299 missense possibly damaging 0.69
IGL02546:Ubqln3 APN 7 104142518 missense probably benign 0.02
IGL02657:Ubqln3 APN 7 104141963 missense probably damaging 0.97
IGL02682:Ubqln3 APN 7 104142065 missense probably benign 0.19
IGL02709:Ubqln3 APN 7 104141336 missense probably benign 0.12
IGL03357:Ubqln3 APN 7 104142556 missense probably benign
PIT4544001:Ubqln3 UTSW 7 104141343 missense probably damaging 0.97
R0180:Ubqln3 UTSW 7 104141840 missense probably damaging 1.00
R0845:Ubqln3 UTSW 7 104142068 missense probably damaging 0.98
R1019:Ubqln3 UTSW 7 104141386 missense probably benign 0.00
R1280:Ubqln3 UTSW 7 104142076 missense possibly damaging 0.85
R1448:Ubqln3 UTSW 7 104142790 missense probably damaging 1.00
R1550:Ubqln3 UTSW 7 104141546 missense probably damaging 0.98
R1617:Ubqln3 UTSW 7 104142860 missense possibly damaging 0.95
R1650:Ubqln3 UTSW 7 104141021 missense possibly damaging 0.84
R2060:Ubqln3 UTSW 7 104142151 missense probably damaging 1.00
R2246:Ubqln3 UTSW 7 104142311 missense probably damaging 1.00
R2263:Ubqln3 UTSW 7 104141635 nonsense probably null
R2366:Ubqln3 UTSW 7 104141049 missense probably damaging 0.99
R4232:Ubqln3 UTSW 7 104141803 missense probably benign 0.00
R4447:Ubqln3 UTSW 7 104142814 missense probably benign 0.31
R4509:Ubqln3 UTSW 7 104141444 missense probably damaging 0.97
R4604:Ubqln3 UTSW 7 104142491 missense probably benign 0.00
R5416:Ubqln3 UTSW 7 104141672 missense probably benign 0.34
R5617:Ubqln3 UTSW 7 104142433 missense probably damaging 0.99
R5648:Ubqln3 UTSW 7 104140910 missense probably damaging 0.99
R5722:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5723:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5724:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5819:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5820:Ubqln3 UTSW 7 104141467 missense probably benign 0.00
R5966:Ubqln3 UTSW 7 104141699 missense probably benign 0.03
R6260:Ubqln3 UTSW 7 104142317 nonsense probably null
R6272:Ubqln3 UTSW 7 104142178 missense probably damaging 1.00
R6542:Ubqln3 UTSW 7 104141617 missense probably benign 0.00
R6936:Ubqln3 UTSW 7 104142310 missense probably damaging 1.00
R7023:Ubqln3 UTSW 7 104141423 missense probably damaging 1.00
R7079:Ubqln3 UTSW 7 104141371 missense probably benign 0.12
R7733:Ubqln3 UTSW 7 104141076 missense probably damaging 0.98
R7764:Ubqln3 UTSW 7 104141236 missense possibly damaging 0.52
R8009:Ubqln3 UTSW 7 104142590 missense probably benign 0.00
RF054:Ubqln3 UTSW 7 104141178 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCTTGTAACACCTGGAGGAAGG -3'
(R):5'- ATGTCAGCTACTCCTGGAGTC -3'

Sequencing Primer
(F):5'- GGAGGAATGGATACCTAGCTCTG -3'
(R):5'- TGGAGTCCCAGAATCTCCCTG -3'
Posted On2019-05-13