Mutagenetix > Incidental Mutation

Incidental Mutation 'R7025:Nrp1'

545913

Institutional Source

Beutler Lab

Gene Symbol

Nrp1

Ensembl Gene

ENSMUSG00000025810

Gene Name

neuropilin 1

Synonyms

Neuropilin-1, NP-1, NPN-1, Npn1

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7025 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

128358604-128503363 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 128480954 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Phenylalanine at position 610 (C610F)

Ref Sequence

ENSEMBL: ENSMUSP00000026917 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026917]

AlphaFold

P97333

PDB Structure

Mouse Neuropilin-1, extracellular domains 1-4 (a1a2b1b2) [X-RAY DIFFRACTION]
Complex of mouse Plexin A2 - Semaphorin 3A - Neuropilin-1 [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000026917
AA Change: C610F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000026917
Gene: ENSMUSG00000025810
AA Change: C610F

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
CUB	27	141	1.44e-43	SMART
CUB	147	265	9.19e-42	SMART
FA58C	274	424	5.21e-44	SMART
FA58C	430	583	4.15e-20	SMART
low complexity region	587	599	N/A	INTRINSIC
MAM	645	811	4.94e-69	SMART
Pfam:DUF3481	837	920	3.5e-31	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two neuropilins, which contain specific protein domains which allow them to participate in several different types of signaling pathways that control cell migration. Neuropilins contain a large N-terminal extracellular domain, made up of complement-binding, coagulation factor V/VIII, and meprin domains. These proteins also contains a short membrane-spanning domain and a small cytoplasmic domain. Neuropilins bind many ligands and various types of co-receptors; they affect cell survival, migration, and attraction. Some of the ligands and co-receptors bound by neuropilins are vascular endothelial growth factor (VEGF) and semaphorin family members. Several alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice show embryonic death, impaired neuronal migration and axon guidance, and vascular defects including a disorganized yolk sac vascular plexus, and malformed brachial arch arteries and great vessels. Mice lacking the cytoplasmic domain show altered retinal arteriovenous patterning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acbd4	T	A	11: 103,104,538	L90M	probably damaging	Het
Acot7	T	C	4: 152,178,189	S7P	unknown	Het
Ahcyl2	T	C	6: 29,908,421	Y388H	probably damaging	Het
Atp1a2	T	A	1: 172,284,550	R593*	probably null	Het
Bicral	T	C	17: 46,801,668	T869A	probably benign	Het
Brca2	C	T	5: 150,540,478	P1236S	probably benign	Het
Cacna2d1	C	T	5: 16,352,668	Q699*	probably null	Het
Ccser2	T	C	14: 36,940,007	N407D	probably damaging	Het
Cd300lg	A	G	11: 102,043,074	Y49C	probably damaging	Het
Cdh12	C	A	15: 21,358,814	T108K	probably damaging	Het
Ctnnd1	A	T	2: 84,610,606	I715K	possibly damaging	Het
Cyp17a1	T	A	19: 46,670,980	D137V	probably damaging	Het
Dbr1	A	G	9: 99,575,983	T19A	probably damaging	Het
Dnah3	C	T	7: 120,030,010	A1441T	possibly damaging	Het
Dpt	G	A	1: 164,796,939	D70N	probably damaging	Het
Elk4	C	A	1: 132,019,369	P366Q	probably damaging	Het
Eml4	A	C	17: 83,425,311	D131A	probably benign	Het
Faap24	A	G	7: 35,392,871	I207T	possibly damaging	Het
Fam198b	T	C	3: 79,886,548	Y108H	probably damaging	Het
Fam219a	T	C	4: 41,521,925	S41G	probably benign	Het
Gm15448	T	A	7: 3,821,262	K629*	probably null	Het
Ifi203	T	C	1: 173,928,385		probably benign	Het
Inpp4a	T	C	1: 37,369,423	V295A	probably benign	Het
Kif2a	A	G	13: 106,982,594	Y267H	probably damaging	Het
Kprp	T	A	3: 92,825,197	Q182L	probably benign	Het
Krt90	T	C	15: 101,557,175	K337R	possibly damaging	Het
Lrp2	T	A	2: 69,483,028	Y2453F	possibly damaging	Het
Magel2	A	C	7: 62,379,787	Y813S	unknown	Het
Myh7	C	A	14: 54,974,644	E1548*	probably null	Het
Myh8	A	G	11: 67,297,539	T1009A	probably benign	Het
Nab2	T	A	10: 127,666,508		probably benign	Het
Neb	T	C	2: 52,296,273	D929G	possibly damaging	Het
Nelfb	A	C	2: 25,210,493	V155G	probably damaging	Het
Nmur1	C	A	1: 86,387,848	M65I	possibly damaging	Het
Nop56	C	T	2: 130,277,881	R81*	probably null	Het
Npnt	C	T	3: 132,908,396	C47Y	probably damaging	Het
Olfr1175-ps	T	C	2: 88,323,262	K148E	probably damaging	Het
Olfr1243	T	A	2: 89,527,604	I269F	probably damaging	Het
Olfr766-ps1	T	A	10: 129,064,675	M1L	probably benign	Het
Pax5	G	A	4: 44,679,501	Q93*	probably null	Het
Pcnt	G	T	10: 76,403,835	Q1273K	probably damaging	Het
Pde4dip	G	A	3: 97,724,183	Q1137*	probably null	Het
Pfas	A	T	11: 68,990,760	D959E	probably benign	Het
Prex1	TCCGACCCC	TCCGACCCCGACCCC	2: 166,613,187		probably benign	Het
Prpf40b	C	T	15: 99,306,400	Q182*	probably null	Het
Ptk2	G	A	15: 73,221,809	P854S	possibly damaging	Het
Rpe65	A	C	3: 159,622,685	E406A	probably damaging	Het
Serpina3k	A	T	12: 104,341,142	Y211F	probably benign	Het
Shkbp1	T	C	7: 27,355,281	I65V	possibly damaging	Het
Slc22a29	G	A	19: 8,160,580	P544S	probably benign	Het
Stab2	T	C	10: 86,850,837	D2281G	probably damaging	Het
Tjp2	A	G	19: 24,132,688	M64T	probably benign	Het
Tnfrsf8	C	T	4: 145,274,403	V378I	possibly damaging	Het
Trpm1	A	T	7: 64,226,714		probably null	Het
Ubqln3	A	G	7: 104,141,275	I536T	probably benign	Het
Vmn1r44	A	G	6: 89,893,754	T161A	possibly damaging	Het
Vmn2r108	T	A	17: 20,471,083	I393F	possibly damaging	Het

Other mutations in Nrp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00911:Nrp1	APN	8	128476207	missense	probably benign
IGL01412:Nrp1	APN	8	128418707	splice site	probably benign
IGL01586:Nrp1	APN	8	128432032	missense	possibly damaging	0.86
IGL02307:Nrp1	APN	8	128502720	missense	probably damaging	1.00
IGL02500:Nrp1	APN	8	128425799	missense	possibly damaging	0.94
IGL02547:Nrp1	APN	8	128493031	missense	probably benign
R0046:Nrp1	UTSW	8	128500608	splice site	probably benign
R0281:Nrp1	UTSW	8	128460683	missense	probably damaging	0.96
R0403:Nrp1	UTSW	8	128457969	missense	probably damaging	1.00
R0610:Nrp1	UTSW	8	128502618	missense	probably damaging	1.00
R1055:Nrp1	UTSW	8	128468598	missense	possibly damaging	0.68
R1229:Nrp1	UTSW	8	128418716	nonsense	probably null
R1263:Nrp1	UTSW	8	128468389	missense	probably damaging	1.00
R1340:Nrp1	UTSW	8	128434355	missense	probably damaging	1.00
R1397:Nrp1	UTSW	8	128418716	nonsense	probably null
R1462:Nrp1	UTSW	8	128502798	missense	probably benign
R1462:Nrp1	UTSW	8	128502798	missense	probably benign
R1531:Nrp1	UTSW	8	128425969	missense	probably null	0.19
R1587:Nrp1	UTSW	8	128476282	missense	probably damaging	1.00
R1719:Nrp1	UTSW	8	128425885	missense	probably damaging	1.00
R1733:Nrp1	UTSW	8	128468493	missense	probably benign	0.02
R1785:Nrp1	UTSW	8	128498516	missense	probably damaging	1.00
R1786:Nrp1	UTSW	8	128498516	missense	probably damaging	1.00
R2047:Nrp1	UTSW	8	128498096	splice site	probably benign
R2130:Nrp1	UTSW	8	128498516	missense	probably damaging	1.00
R2132:Nrp1	UTSW	8	128498516	missense	probably damaging	1.00
R2133:Nrp1	UTSW	8	128498516	missense	probably damaging	1.00
R2163:Nrp1	UTSW	8	128497871	missense	probably damaging	1.00
R2338:Nrp1	UTSW	8	128497904	missense	probably benign	0.01
R2407:Nrp1	UTSW	8	128431945	missense	probably damaging	0.99
R3405:Nrp1	UTSW	8	128498088	nonsense	probably null
R3748:Nrp1	UTSW	8	128457980	missense	probably damaging	1.00
R4347:Nrp1	UTSW	8	128480991	critical splice donor site	probably null
R4379:Nrp1	UTSW	8	128468467	missense	probably damaging	1.00
R4646:Nrp1	UTSW	8	128457944	missense	probably benign	0.00
R4688:Nrp1	UTSW	8	128502566	missense	probably benign	0.01
R4916:Nrp1	UTSW	8	128502804	nonsense	probably null
R5077:Nrp1	UTSW	8	128500673	critical splice donor site	probably null
R5301:Nrp1	UTSW	8	128434197	splice site	probably null
R5509:Nrp1	UTSW	8	128425915	missense	possibly damaging	0.73
R5745:Nrp1	UTSW	8	128468448	missense	probably benign	0.22
R5873:Nrp1	UTSW	8	128468377	missense	probably damaging	1.00
R5987:Nrp1	UTSW	8	128476169	missense	probably damaging	1.00
R6060:Nrp1	UTSW	8	128497938	missense	probably damaging	1.00
R6757:Nrp1	UTSW	8	128425868	missense	probably damaging	1.00
R6889:Nrp1	UTSW	8	128493057	missense	probably damaging	1.00
R7065:Nrp1	UTSW	8	128460712	missense	probably benign
R7290:Nrp1	UTSW	8	128476296	critical splice donor site	probably null
R7369:Nrp1	UTSW	8	128431915	missense	probably damaging	1.00
R7553:Nrp1	UTSW	8	128431987	missense	probably damaging	1.00
R7650:Nrp1	UTSW	8	128498014	missense	possibly damaging	0.87
R8043:Nrp1	UTSW	8	128432023	missense	probably benign	0.00
R8088:Nrp1	UTSW	8	128468516	nonsense	probably null
R8193:Nrp1	UTSW	8	128460706	missense	probably damaging	1.00
R8206:Nrp1	UTSW	8	128457957	missense	probably damaging	0.99
R8245:Nrp1	UTSW	8	128487953	missense	probably benign
R8684:Nrp1	UTSW	8	128359404	start gained	probably benign
R8734:Nrp1	UTSW	8	128480939	missense	probably benign	0.23
R8875:Nrp1	UTSW	8	128480991	critical splice donor site	probably null
R9054:Nrp1	UTSW	8	128487908	missense	probably benign
R9253:Nrp1	UTSW	8	128502663	missense	possibly damaging	0.47
R9301:Nrp1	UTSW	8	128363378	missense	probably damaging	1.00
R9437:Nrp1	UTSW	8	128460627	missense	probably benign	0.01
R9606:Nrp1	UTSW	8	128502548	missense	probably benign	0.00
R9607:Nrp1	UTSW	8	128425781	missense	probably benign	0.01
R9691:Nrp1	UTSW	8	128476169	missense	probably damaging	1.00
X0066:Nrp1	UTSW	8	128460645	missense	possibly damaging	0.95
Z1186:Nrp1	UTSW	8	128497938	missense	probably damaging	1.00
Z1189:Nrp1	UTSW	8	128497938	missense	probably damaging	1.00
Z1192:Nrp1	UTSW	8	128497938	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGGAGTATTCCCGAGAGAGG -3'
(R):5'- CAGCCACCAGGAGTAATTGG -3'

Sequencing Primer
(F):5'- AGAGGCGGAACATGTCCCTG -3'
(R):5'- CAGCCACCAGGAGTAATTGGTTTAC -3'

Posted On

2019-05-13