Incidental Mutation 'R7025:Dbr1'
ID545914
Institutional Source Beutler Lab
Gene Symbol Dbr1
Ensembl Gene ENSMUSG00000032469
Gene Namedebranching RNA lariats 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7025 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location99575799-99584501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99575983 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 19 (T19A)
Ref Sequence ENSEMBL: ENSMUSP00000070991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066650] [ENSMUST00000139796] [ENSMUST00000148987]
Predicted Effect probably damaging
Transcript: ENSMUST00000066650
AA Change: T19A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000070991
Gene: ENSMUSG00000032469
AA Change: T19A

DomainStartEndE-ValueType
Pfam:Metallophos 1 230 1.8e-11 PFAM
DBR1 235 380 8.27e-85 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136884
SMART Domains Protein: ENSMUSP00000114670
Gene: ENSMUSG00000032469

DomainStartEndE-ValueType
DBR1 20 128 4.22e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138002
SMART Domains Protein: ENSMUSP00000119924
Gene: ENSMUSG00000032469

DomainStartEndE-ValueType
Pfam:Metallophos 2 144 5.5e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139796
SMART Domains Protein: ENSMUSP00000115203
Gene: ENSMUSG00000032469

DomainStartEndE-ValueType
Pfam:DBR1 52 82 1.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148987
AA Change: T19A

PolyPhen 2 Score 0.261 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000115074
Gene: ENSMUSG00000032469
AA Change: T19A

DomainStartEndE-ValueType
DBR1 162 231 1.34e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156035
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an RNA lariat debranching enzyme that hydrolyzes 2'-5' prime branched phosphodiester bonds. The encoded protein specifically targets the bonds at the branch point of excised lariat intron RNA, converting them to linear molecules that are then degraded. This protein may also be involved in retroviral replication. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit prenatal lethality. Mice heterozygous for this allele exhibit impaired class switch recombination in B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd4 T A 11: 103,104,538 L90M probably damaging Het
Acot7 T C 4: 152,178,189 S7P unknown Het
Ahcyl2 T C 6: 29,908,421 Y388H probably damaging Het
Atp1a2 T A 1: 172,284,550 R593* probably null Het
Bicral T C 17: 46,801,668 T869A probably benign Het
Brca2 C T 5: 150,540,478 P1236S probably benign Het
Cacna2d1 C T 5: 16,352,668 Q699* probably null Het
Ccser2 T C 14: 36,940,007 N407D probably damaging Het
Cd300lg A G 11: 102,043,074 Y49C probably damaging Het
Cdh12 C A 15: 21,358,814 T108K probably damaging Het
Ctnnd1 A T 2: 84,610,606 I715K possibly damaging Het
Cyp17a1 T A 19: 46,670,980 D137V probably damaging Het
Dnah3 C T 7: 120,030,010 A1441T possibly damaging Het
Dpt G A 1: 164,796,939 D70N probably damaging Het
Elk4 C A 1: 132,019,369 P366Q probably damaging Het
Eml4 A C 17: 83,425,311 D131A probably benign Het
Faap24 A G 7: 35,392,871 I207T possibly damaging Het
Fam198b T C 3: 79,886,548 Y108H probably damaging Het
Fam219a T C 4: 41,521,925 S41G probably benign Het
Gm15448 T A 7: 3,821,262 K629* probably null Het
Ifi203 T C 1: 173,928,385 probably benign Het
Inpp4a T C 1: 37,369,423 V295A probably benign Het
Kif2a A G 13: 106,982,594 Y267H probably damaging Het
Kprp T A 3: 92,825,197 Q182L probably benign Het
Krt90 T C 15: 101,557,175 K337R possibly damaging Het
Lrp2 T A 2: 69,483,028 Y2453F possibly damaging Het
Magel2 A C 7: 62,379,787 Y813S unknown Het
Myh7 C A 14: 54,974,644 E1548* probably null Het
Myh8 A G 11: 67,297,539 T1009A probably benign Het
Nab2 T A 10: 127,666,508 probably benign Het
Neb T C 2: 52,296,273 D929G possibly damaging Het
Nelfb A C 2: 25,210,493 V155G probably damaging Het
Nmur1 C A 1: 86,387,848 M65I possibly damaging Het
Nop56 C T 2: 130,277,881 R81* probably null Het
Npnt C T 3: 132,908,396 C47Y probably damaging Het
Nrp1 G T 8: 128,480,954 C610F probably damaging Het
Olfr1175-ps T C 2: 88,323,262 K148E probably damaging Het
Olfr1243 T A 2: 89,527,604 I269F probably damaging Het
Olfr766-ps1 T A 10: 129,064,675 M1L probably benign Het
Pax5 G A 4: 44,679,501 Q93* probably null Het
Pcnt G T 10: 76,403,835 Q1273K probably damaging Het
Pde4dip G A 3: 97,724,183 Q1137* probably null Het
Pfas A T 11: 68,990,760 D959E probably benign Het
Prex1 TCCGACCCC TCCGACCCCGACCCC 2: 166,613,187 probably benign Het
Prpf40b C T 15: 99,306,400 Q182* probably null Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rpe65 A C 3: 159,622,685 E406A probably damaging Het
Serpina3k A T 12: 104,341,142 Y211F probably benign Het
Shkbp1 T C 7: 27,355,281 I65V possibly damaging Het
Slc22a29 G A 19: 8,160,580 P544S probably benign Het
Stab2 T C 10: 86,850,837 D2281G probably damaging Het
Tjp2 A G 19: 24,132,688 M64T probably benign Het
Tnfrsf8 C T 4: 145,274,403 V378I possibly damaging Het
Trpm1 A T 7: 64,226,714 probably null Het
Ubqln3 A G 7: 104,141,275 I536T probably benign Het
Vmn1r44 A G 6: 89,893,754 T161A possibly damaging Het
Vmn2r108 T A 17: 20,471,083 I393F possibly damaging Het
Other mutations in Dbr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01642:Dbr1 APN 9 99575978 missense probably damaging 1.00
IGL01952:Dbr1 APN 9 99582412 missense possibly damaging 0.64
IGL01995:Dbr1 APN 9 99583899 missense probably benign 0.00
FR4340:Dbr1 UTSW 9 99583701 unclassified probably benign
FR4342:Dbr1 UTSW 9 99583680 unclassified probably benign
FR4449:Dbr1 UTSW 9 99583674 unclassified probably benign
FR4449:Dbr1 UTSW 9 99583686 unclassified probably benign
FR4449:Dbr1 UTSW 9 99583696 unclassified probably benign
FR4548:Dbr1 UTSW 9 99583673 nonsense probably null
FR4589:Dbr1 UTSW 9 99583677 unclassified probably benign
FR4589:Dbr1 UTSW 9 99583680 unclassified probably benign
FR4589:Dbr1 UTSW 9 99583683 unclassified probably benign
FR4589:Dbr1 UTSW 9 99583696 unclassified probably benign
FR4737:Dbr1 UTSW 9 99583686 unclassified probably benign
FR4737:Dbr1 UTSW 9 99583699 unclassified probably benign
FR4976:Dbr1 UTSW 9 99583689 unclassified probably benign
FR4976:Dbr1 UTSW 9 99583692 unclassified probably benign
FR4976:Dbr1 UTSW 9 99583701 unclassified probably benign
FR4976:Dbr1 UTSW 9 99583702 unclassified probably benign
PIT4131001:Dbr1 UTSW 9 99584019 splice site probably null
R0100:Dbr1 UTSW 9 99583669 missense probably benign 0.01
R1240:Dbr1 UTSW 9 99584020 missense probably benign 0.44
R1502:Dbr1 UTSW 9 99582387 missense probably damaging 1.00
R2265:Dbr1 UTSW 9 99579410 missense probably damaging 1.00
R2279:Dbr1 UTSW 9 99580147 missense probably benign 0.06
R5202:Dbr1 UTSW 9 99583891 missense probably benign 0.00
R7012:Dbr1 UTSW 9 99583321 nonsense probably null
R7037:Dbr1 UTSW 9 99576568 splice site probably null
R7192:Dbr1 UTSW 9 99576702 critical splice donor site probably null
R7350:Dbr1 UTSW 9 99582549 missense
R7396:Dbr1 UTSW 9 99583390 missense probably damaging 1.00
R7601:Dbr1 UTSW 9 99582602 nonsense probably null
R7659:Dbr1 UTSW 9 99576610 missense probably damaging 1.00
RF028:Dbr1 UTSW 9 99583697 nonsense probably null
RF033:Dbr1 UTSW 9 99583697 nonsense probably null
RF038:Dbr1 UTSW 9 99583697 unclassified probably benign
RF040:Dbr1 UTSW 9 99583697 nonsense probably null
RF043:Dbr1 UTSW 9 99583697 unclassified probably benign
RF045:Dbr1 UTSW 9 99583671 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TAAAGGACTCGAAACTCAGCCG -3'
(R):5'- AACAGACATCGCGATCTGC -3'

Sequencing Primer
(F):5'- GCGGCTCGGTTGGTGTTG -3'
(R):5'- AGCAGGACCTGGAACCC -3'
Posted On2019-05-13