Incidental Mutation 'R7025:Myh8'
ID 545919
Institutional Source Beutler Lab
Gene Symbol Myh8
Ensembl Gene ENSMUSG00000055775
Gene Name myosin, heavy polypeptide 8, skeletal muscle, perinatal
Synonyms Myhsp, MyHC-pn, Myhs-p, 4832426G23Rik
MMRRC Submission 045126-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.825) question?
Stock # R7025 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 67167950-67199460 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 67188365 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 1009 (T1009A)
Ref Sequence ENSEMBL: ENSMUSP00000019625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019625]
AlphaFold P13542
Predicted Effect probably benign
Transcript: ENSMUST00000019625
AA Change: T1009A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000019625
Gene: ENSMUSG00000055775
AA Change: T1009A

DomainStartEndE-ValueType
Pfam:Myosin_N 37 76 2.1e-13 PFAM
MYSc 82 782 N/A SMART
IQ 783 805 5.44e-3 SMART
Pfam:Myosin_tail_1 846 1927 2.4e-164 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a myosin heavy chain. The encoded protein forms a hexamer with two heavy chains, two alkali light chains, and two regulatory light chain components. This complex functions in muscle contraction. This gene is located in a cluster of related genes on chromosome 11. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd4 T A 11: 102,995,364 (GRCm39) L90M probably damaging Het
Acot7 T C 4: 152,262,646 (GRCm39) S7P unknown Het
Ahcyl2 T C 6: 29,908,420 (GRCm39) Y388H probably damaging Het
Atp1a2 T A 1: 172,112,117 (GRCm39) R593* probably null Het
Bicral T C 17: 47,112,594 (GRCm39) T869A probably benign Het
Brca2 C T 5: 150,463,943 (GRCm39) P1236S probably benign Het
Cacna2d1 C T 5: 16,557,666 (GRCm39) Q699* probably null Het
Ccser2 T C 14: 36,661,964 (GRCm39) N407D probably damaging Het
Cd300lg A G 11: 101,933,900 (GRCm39) Y49C probably damaging Het
Cdh12 C A 15: 21,358,900 (GRCm39) T108K probably damaging Het
Ctnnd1 A T 2: 84,440,950 (GRCm39) I715K possibly damaging Het
Cyp17a1 T A 19: 46,659,419 (GRCm39) D137V probably damaging Het
Dbr1 A G 9: 99,458,036 (GRCm39) T19A probably damaging Het
Dnah3 C T 7: 119,629,233 (GRCm39) A1441T possibly damaging Het
Dpt G A 1: 164,624,508 (GRCm39) D70N probably damaging Het
Elk4 C A 1: 131,947,107 (GRCm39) P366Q probably damaging Het
Eml4 A C 17: 83,732,740 (GRCm39) D131A probably benign Het
Faap24 A G 7: 35,092,296 (GRCm39) I207T possibly damaging Het
Fam219a T C 4: 41,521,925 (GRCm39) S41G probably benign Het
Gask1b T C 3: 79,793,855 (GRCm39) Y108H probably damaging Het
Ifi203 T C 1: 173,755,951 (GRCm39) probably benign Het
Inpp4a T C 1: 37,408,504 (GRCm39) V295A probably benign Het
Kif2a A G 13: 107,119,102 (GRCm39) Y267H probably damaging Het
Kprp T A 3: 92,732,504 (GRCm39) Q182L probably benign Het
Krt90 T C 15: 101,465,610 (GRCm39) K337R possibly damaging Het
Lrp2 T A 2: 69,313,372 (GRCm39) Y2453F possibly damaging Het
Magel2 A C 7: 62,029,535 (GRCm39) Y813S unknown Het
Myh7 C A 14: 55,212,101 (GRCm39) E1548* probably null Het
Nab2 T A 10: 127,502,377 (GRCm39) probably benign Het
Neb T C 2: 52,186,285 (GRCm39) D929G possibly damaging Het
Nelfb A C 2: 25,100,505 (GRCm39) V155G probably damaging Het
Nmur1 C A 1: 86,315,570 (GRCm39) M65I possibly damaging Het
Nop56 C T 2: 130,119,801 (GRCm39) R81* probably null Het
Npnt C T 3: 132,614,157 (GRCm39) C47Y probably damaging Het
Nrp1 G T 8: 129,207,435 (GRCm39) C610F probably damaging Het
Or4a71 T A 2: 89,357,948 (GRCm39) I269F probably damaging Het
Or5d45 T C 2: 88,153,606 (GRCm39) K148E probably damaging Het
Or6c63-ps1 T A 10: 128,900,544 (GRCm39) M1L probably benign Het
Pax5 G A 4: 44,679,501 (GRCm39) Q93* probably null Het
Pcnt G T 10: 76,239,669 (GRCm39) Q1273K probably damaging Het
Pde4dip G A 3: 97,631,499 (GRCm39) Q1137* probably null Het
Pfas A T 11: 68,881,586 (GRCm39) D959E probably benign Het
Pira13 T A 7: 3,824,261 (GRCm39) K629* probably null Het
Prex1 TCCGACCCC TCCGACCCCGACCCC 2: 166,455,107 (GRCm39) probably benign Het
Prpf40b C T 15: 99,204,281 (GRCm39) Q182* probably null Het
Ptk2 G A 15: 73,093,658 (GRCm39) P854S possibly damaging Het
Rpe65 A C 3: 159,328,322 (GRCm39) E406A probably damaging Het
Serpina3k A T 12: 104,307,401 (GRCm39) Y211F probably benign Het
Shkbp1 T C 7: 27,054,706 (GRCm39) I65V possibly damaging Het
Slc22a29 G A 19: 8,137,944 (GRCm39) P544S probably benign Het
Stab2 T C 10: 86,686,701 (GRCm39) D2281G probably damaging Het
Tjp2 A G 19: 24,110,052 (GRCm39) M64T probably benign Het
Tnfrsf8 C T 4: 145,000,973 (GRCm39) V378I possibly damaging Het
Trpm1 A T 7: 63,876,462 (GRCm39) probably null Het
Ubqln3 A G 7: 103,790,482 (GRCm39) I536T probably benign Het
Vmn1r44 A G 6: 89,870,736 (GRCm39) T161A possibly damaging Het
Vmn2r108 T A 17: 20,691,345 (GRCm39) I393F possibly damaging Het
Other mutations in Myh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Myh8 APN 11 67,174,644 (GRCm39) missense probably damaging 0.97
IGL01020:Myh8 APN 11 67,174,229 (GRCm39) missense probably damaging 0.99
IGL01348:Myh8 APN 11 67,188,606 (GRCm39) missense probably damaging 1.00
IGL01382:Myh8 APN 11 67,192,799 (GRCm39) missense probably damaging 1.00
IGL01454:Myh8 APN 11 67,174,422 (GRCm39) missense probably damaging 1.00
IGL01457:Myh8 APN 11 67,183,505 (GRCm39) missense probably benign 0.00
IGL01472:Myh8 APN 11 67,179,205 (GRCm39) splice site probably benign
IGL01473:Myh8 APN 11 67,192,651 (GRCm39) critical splice donor site probably null
IGL01613:Myh8 APN 11 67,192,536 (GRCm39) missense probably benign 0.11
IGL01763:Myh8 APN 11 67,177,245 (GRCm39) missense probably benign 0.01
IGL01828:Myh8 APN 11 67,194,652 (GRCm39) missense possibly damaging 0.82
IGL01862:Myh8 APN 11 67,180,520 (GRCm39) nonsense probably null
IGL01905:Myh8 APN 11 67,175,477 (GRCm39) missense possibly damaging 0.90
IGL02280:Myh8 APN 11 67,174,198 (GRCm39) unclassified probably benign
IGL02386:Myh8 APN 11 67,185,266 (GRCm39) missense probably damaging 0.99
IGL02449:Myh8 APN 11 67,185,440 (GRCm39) critical splice donor site probably null
IGL02500:Myh8 APN 11 67,196,536 (GRCm39) missense probably benign 0.00
IGL02745:Myh8 APN 11 67,188,327 (GRCm39) missense possibly damaging 0.88
IGL02799:Myh8 APN 11 67,192,418 (GRCm39) splice site probably benign
IGL03063:Myh8 APN 11 67,179,031 (GRCm39) missense probably benign 0.00
IGL03223:Myh8 APN 11 67,174,644 (GRCm39) missense probably damaging 0.97
IGL03336:Myh8 APN 11 67,175,528 (GRCm39) missense probably damaging 1.00
IGL03338:Myh8 APN 11 67,189,172 (GRCm39) missense probably damaging 1.00
IGL03351:Myh8 APN 11 67,194,739 (GRCm39) missense possibly damaging 0.94
IGL03392:Myh8 APN 11 67,185,244 (GRCm39) missense probably damaging 1.00
BB003:Myh8 UTSW 11 67,169,732 (GRCm39) missense possibly damaging 0.94
BB009:Myh8 UTSW 11 67,185,430 (GRCm39) missense probably benign 0.00
BB013:Myh8 UTSW 11 67,169,732 (GRCm39) missense possibly damaging 0.94
BB019:Myh8 UTSW 11 67,185,430 (GRCm39) missense probably benign 0.00
PIT4354001:Myh8 UTSW 11 67,180,456 (GRCm39) missense probably benign 0.01
R0012:Myh8 UTSW 11 67,190,847 (GRCm39) missense probably benign 0.02
R0016:Myh8 UTSW 11 67,189,351 (GRCm39) missense probably damaging 1.00
R0016:Myh8 UTSW 11 67,189,351 (GRCm39) missense probably damaging 1.00
R0115:Myh8 UTSW 11 67,197,090 (GRCm39) splice site probably benign
R0131:Myh8 UTSW 11 67,183,014 (GRCm39) missense probably damaging 0.96
R0131:Myh8 UTSW 11 67,183,014 (GRCm39) missense probably damaging 0.96
R0132:Myh8 UTSW 11 67,183,014 (GRCm39) missense probably damaging 0.96
R0238:Myh8 UTSW 11 67,192,518 (GRCm39) missense probably benign 0.00
R0238:Myh8 UTSW 11 67,192,518 (GRCm39) missense probably benign 0.00
R0239:Myh8 UTSW 11 67,192,518 (GRCm39) missense probably benign 0.00
R0239:Myh8 UTSW 11 67,192,518 (GRCm39) missense probably benign 0.00
R0393:Myh8 UTSW 11 67,196,843 (GRCm39) splice site probably benign
R0453:Myh8 UTSW 11 67,183,731 (GRCm39) missense probably benign 0.03
R0454:Myh8 UTSW 11 67,194,591 (GRCm39) nonsense probably null
R0466:Myh8 UTSW 11 67,189,405 (GRCm39) missense probably benign 0.01
R0487:Myh8 UTSW 11 67,192,837 (GRCm39) missense probably benign
R0511:Myh8 UTSW 11 67,175,333 (GRCm39) missense probably benign 0.01
R0557:Myh8 UTSW 11 67,192,624 (GRCm39) missense possibly damaging 0.88
R0589:Myh8 UTSW 11 67,189,453 (GRCm39) missense probably benign 0.00
R0658:Myh8 UTSW 11 67,175,358 (GRCm39) critical splice donor site probably null
R0782:Myh8 UTSW 11 67,180,580 (GRCm39) missense probably benign 0.16
R0829:Myh8 UTSW 11 67,174,326 (GRCm39) unclassified probably benign
R0845:Myh8 UTSW 11 67,177,090 (GRCm39) missense probably damaging 1.00
R0930:Myh8 UTSW 11 67,196,824 (GRCm39) missense possibly damaging 0.93
R0972:Myh8 UTSW 11 67,188,585 (GRCm39) missense probably damaging 1.00
R1132:Myh8 UTSW 11 67,187,957 (GRCm39) nonsense probably null
R1417:Myh8 UTSW 11 67,197,011 (GRCm39) missense probably damaging 1.00
R1478:Myh8 UTSW 11 67,183,551 (GRCm39) missense probably benign 0.23
R1497:Myh8 UTSW 11 67,180,638 (GRCm39) missense probably benign 0.00
R1605:Myh8 UTSW 11 67,192,497 (GRCm39) missense probably damaging 0.99
R1701:Myh8 UTSW 11 67,170,964 (GRCm39) missense probably damaging 1.00
R1950:Myh8 UTSW 11 67,169,830 (GRCm39) missense possibly damaging 0.75
R1989:Myh8 UTSW 11 67,183,550 (GRCm39) missense probably benign 0.00
R2010:Myh8 UTSW 11 67,187,990 (GRCm39) nonsense probably null
R2095:Myh8 UTSW 11 67,177,050 (GRCm39) missense probably benign 0.00
R2132:Myh8 UTSW 11 67,183,702 (GRCm39) missense probably damaging 1.00
R2152:Myh8 UTSW 11 67,185,295 (GRCm39) missense probably damaging 0.97
R2229:Myh8 UTSW 11 67,199,174 (GRCm39) missense probably damaging 0.98
R2302:Myh8 UTSW 11 67,177,065 (GRCm39) missense probably damaging 1.00
R2364:Myh8 UTSW 11 67,185,344 (GRCm39) missense probably benign 0.03
R2429:Myh8 UTSW 11 67,194,723 (GRCm39) missense probably benign 0.21
R2880:Myh8 UTSW 11 67,188,090 (GRCm39) missense probably damaging 0.97
R3692:Myh8 UTSW 11 67,192,744 (GRCm39) missense probably damaging 0.98
R3756:Myh8 UTSW 11 67,175,443 (GRCm39) unclassified probably benign
R3924:Myh8 UTSW 11 67,187,963 (GRCm39) missense probably damaging 0.99
R4172:Myh8 UTSW 11 67,183,247 (GRCm39) missense probably damaging 1.00
R4255:Myh8 UTSW 11 67,190,560 (GRCm39) missense probably benign
R4621:Myh8 UTSW 11 67,177,084 (GRCm39) missense probably damaging 1.00
R4623:Myh8 UTSW 11 67,177,084 (GRCm39) missense probably damaging 1.00
R4790:Myh8 UTSW 11 67,170,789 (GRCm39) missense probably damaging 0.99
R4914:Myh8 UTSW 11 67,183,510 (GRCm39) missense probably damaging 1.00
R5074:Myh8 UTSW 11 67,196,742 (GRCm39) missense possibly damaging 0.79
R5119:Myh8 UTSW 11 67,189,184 (GRCm39) missense probably damaging 1.00
R5159:Myh8 UTSW 11 67,179,179 (GRCm39) missense probably damaging 0.99
R5229:Myh8 UTSW 11 67,175,310 (GRCm39) missense probably damaging 0.96
R5320:Myh8 UTSW 11 67,177,089 (GRCm39) missense probably damaging 1.00
R5455:Myh8 UTSW 11 67,192,244 (GRCm39) missense possibly damaging 0.59
R5523:Myh8 UTSW 11 67,196,788 (GRCm39) missense possibly damaging 0.95
R5540:Myh8 UTSW 11 67,177,266 (GRCm39) missense probably benign 0.00
R5726:Myh8 UTSW 11 67,185,392 (GRCm39) missense possibly damaging 0.79
R5770:Myh8 UTSW 11 67,188,026 (GRCm39) missense probably damaging 1.00
R6135:Myh8 UTSW 11 67,188,326 (GRCm39) missense possibly damaging 0.51
R6253:Myh8 UTSW 11 67,192,793 (GRCm39) missense probably benign 0.06
R6318:Myh8 UTSW 11 67,190,167 (GRCm39) missense probably benign 0.00
R6432:Myh8 UTSW 11 67,189,405 (GRCm39) missense probably benign 0.01
R6452:Myh8 UTSW 11 67,196,565 (GRCm39) missense possibly damaging 0.88
R6452:Myh8 UTSW 11 67,183,275 (GRCm39) missense probably benign 0.27
R6512:Myh8 UTSW 11 67,180,488 (GRCm39) nonsense probably null
R6714:Myh8 UTSW 11 67,197,775 (GRCm39) missense probably damaging 1.00
R6842:Myh8 UTSW 11 67,175,481 (GRCm39) missense probably damaging 1.00
R7007:Myh8 UTSW 11 67,179,142 (GRCm39) missense probably benign 0.03
R7086:Myh8 UTSW 11 67,183,453 (GRCm39) splice site probably null
R7098:Myh8 UTSW 11 67,169,879 (GRCm39) missense probably benign 0.03
R7498:Myh8 UTSW 11 67,174,263 (GRCm39) missense possibly damaging 0.80
R7716:Myh8 UTSW 11 67,189,478 (GRCm39) missense possibly damaging 0.51
R7765:Myh8 UTSW 11 67,194,481 (GRCm39) missense probably benign 0.44
R7825:Myh8 UTSW 11 67,194,538 (GRCm39) missense possibly damaging 0.94
R7921:Myh8 UTSW 11 67,174,644 (GRCm39) missense probably damaging 0.97
R7926:Myh8 UTSW 11 67,169,732 (GRCm39) missense possibly damaging 0.94
R7932:Myh8 UTSW 11 67,185,430 (GRCm39) missense probably benign 0.00
R8003:Myh8 UTSW 11 67,190,586 (GRCm39) missense probably damaging 1.00
R8028:Myh8 UTSW 11 67,194,502 (GRCm39) missense possibly damaging 0.65
R8121:Myh8 UTSW 11 67,180,647 (GRCm39) missense probably benign 0.00
R8125:Myh8 UTSW 11 67,190,598 (GRCm39) missense possibly damaging 0.94
R8170:Myh8 UTSW 11 67,179,092 (GRCm39) missense probably benign 0.30
R8277:Myh8 UTSW 11 67,183,735 (GRCm39) missense probably benign 0.10
R8304:Myh8 UTSW 11 67,195,162 (GRCm39) missense possibly damaging 0.72
R8431:Myh8 UTSW 11 67,174,440 (GRCm39) missense possibly damaging 0.94
R8535:Myh8 UTSW 11 67,169,741 (GRCm39) missense probably damaging 1.00
R8795:Myh8 UTSW 11 67,174,203 (GRCm39) critical splice acceptor site probably benign
R8858:Myh8 UTSW 11 67,192,820 (GRCm39) missense possibly damaging 0.67
R8927:Myh8 UTSW 11 67,174,081 (GRCm39) missense probably benign 0.10
R8928:Myh8 UTSW 11 67,174,081 (GRCm39) missense probably benign 0.10
R9031:Myh8 UTSW 11 67,190,141 (GRCm39) missense possibly damaging 0.49
R9172:Myh8 UTSW 11 67,183,260 (GRCm39) missense possibly damaging 0.82
R9252:Myh8 UTSW 11 67,177,302 (GRCm39) missense probably damaging 1.00
R9365:Myh8 UTSW 11 67,174,632 (GRCm39) missense probably benign 0.42
R9468:Myh8 UTSW 11 67,197,730 (GRCm39) missense probably damaging 1.00
R9564:Myh8 UTSW 11 67,177,215 (GRCm39) missense probably benign 0.40
R9565:Myh8 UTSW 11 67,177,215 (GRCm39) missense probably benign 0.40
T0722:Myh8 UTSW 11 67,195,262 (GRCm39) missense probably benign 0.41
Z1088:Myh8 UTSW 11 67,189,418 (GRCm39) missense probably damaging 1.00
Z1176:Myh8 UTSW 11 67,194,500 (GRCm39) missense probably damaging 1.00
Z1177:Myh8 UTSW 11 67,199,181 (GRCm39) missense possibly damaging 0.64
Z1177:Myh8 UTSW 11 67,192,250 (GRCm39) missense probably damaging 0.99
Z1187:Myh8 UTSW 11 67,188,312 (GRCm39) missense probably benign
Z1188:Myh8 UTSW 11 67,188,312 (GRCm39) missense probably benign
Z1190:Myh8 UTSW 11 67,188,312 (GRCm39) missense probably benign
Z1191:Myh8 UTSW 11 67,188,312 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CACTGGCCAAGGTTGAGAAG -3'
(R):5'- CTAGCGATCCCTCAAGCTGATG -3'

Sequencing Primer
(F):5'- GTCTACACGGGAAGCTTATGACTC -3'
(R):5'- TGGGGAAAGAGAAACCTGTTAAAATC -3'
Posted On 2019-05-13