Incidental Mutation 'R7025:Cdh12'
ID545927
Institutional Source Beutler Lab
Gene Symbol Cdh12
Ensembl Gene ENSMUSG00000040452
Gene Namecadherin 12
SynonymsBr-cadherin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R7025 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location20449265-21589533 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 21358814 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 108 (T108K)
Ref Sequence ENSEMBL: ENSMUSP00000153750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075132] [ENSMUST00000227496]
Predicted Effect probably damaging
Transcript: ENSMUST00000075132
AA Change: T108K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074632
Gene: ENSMUSG00000040452
AA Change: T108K

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
CA 77 158 5.18e-18 SMART
CA 182 267 4.4e-30 SMART
CA 291 383 2.42e-18 SMART
CA 406 487 7.55e-20 SMART
CA 510 597 9.3e-2 SMART
transmembrane domain 615 637 N/A INTRINSIC
Pfam:Cadherin_C 640 784 1.7e-54 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000227496
AA Change: T108K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. This gene is expressed in both the excitatory and inhibitory neurons in various areas of the adult central nervous system including the cerebellum, neocortex, hippocampus and in different subcortical nuclei. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 15. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd4 T A 11: 103,104,538 L90M probably damaging Het
Acot7 T C 4: 152,178,189 S7P unknown Het
Ahcyl2 T C 6: 29,908,421 Y388H probably damaging Het
Atp1a2 T A 1: 172,284,550 R593* probably null Het
Bicral T C 17: 46,801,668 T869A probably benign Het
Brca2 C T 5: 150,540,478 P1236S probably benign Het
Cacna2d1 C T 5: 16,352,668 Q699* probably null Het
Ccser2 T C 14: 36,940,007 N407D probably damaging Het
Cd300lg A G 11: 102,043,074 Y49C probably damaging Het
Ctnnd1 A T 2: 84,610,606 I715K possibly damaging Het
Cyp17a1 T A 19: 46,670,980 D137V probably damaging Het
Dbr1 A G 9: 99,575,983 T19A probably damaging Het
Dnah3 C T 7: 120,030,010 A1441T possibly damaging Het
Dpt G A 1: 164,796,939 D70N probably damaging Het
Elk4 C A 1: 132,019,369 P366Q probably damaging Het
Eml4 A C 17: 83,425,311 D131A probably benign Het
Faap24 A G 7: 35,392,871 I207T possibly damaging Het
Fam198b T C 3: 79,886,548 Y108H probably damaging Het
Fam219a T C 4: 41,521,925 S41G probably benign Het
Gm15448 T A 7: 3,821,262 K629* probably null Het
Ifi203 T C 1: 173,928,385 probably benign Het
Inpp4a T C 1: 37,369,423 V295A probably benign Het
Kif2a A G 13: 106,982,594 Y267H probably damaging Het
Kprp T A 3: 92,825,197 Q182L probably benign Het
Krt90 T C 15: 101,557,175 K337R possibly damaging Het
Lrp2 T A 2: 69,483,028 Y2453F possibly damaging Het
Magel2 A C 7: 62,379,787 Y813S unknown Het
Myh7 C A 14: 54,974,644 E1548* probably null Het
Myh8 A G 11: 67,297,539 T1009A probably benign Het
Nab2 T A 10: 127,666,508 probably benign Het
Neb T C 2: 52,296,273 D929G possibly damaging Het
Nelfb A C 2: 25,210,493 V155G probably damaging Het
Nmur1 C A 1: 86,387,848 M65I possibly damaging Het
Nop56 C T 2: 130,277,881 R81* probably null Het
Npnt C T 3: 132,908,396 C47Y probably damaging Het
Nrp1 G T 8: 128,480,954 C610F probably damaging Het
Olfr1175-ps T C 2: 88,323,262 K148E probably damaging Het
Olfr1243 T A 2: 89,527,604 I269F probably damaging Het
Olfr766-ps1 T A 10: 129,064,675 M1L probably benign Het
Pax5 G A 4: 44,679,501 Q93* probably null Het
Pcnt G T 10: 76,403,835 Q1273K probably damaging Het
Pde4dip G A 3: 97,724,183 Q1137* probably null Het
Pfas A T 11: 68,990,760 D959E probably benign Het
Prex1 TCCGACCCC TCCGACCCCGACCCC 2: 166,613,187 probably benign Het
Prpf40b C T 15: 99,306,400 Q182* probably null Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rpe65 A C 3: 159,622,685 E406A probably damaging Het
Serpina3k A T 12: 104,341,142 Y211F probably benign Het
Shkbp1 T C 7: 27,355,281 I65V possibly damaging Het
Slc22a29 G A 19: 8,160,580 P544S probably benign Het
Stab2 T C 10: 86,850,837 D2281G probably damaging Het
Tjp2 A G 19: 24,132,688 M64T probably benign Het
Tnfrsf8 C T 4: 145,274,403 V378I possibly damaging Het
Trpm1 A T 7: 64,226,714 probably null Het
Ubqln3 A G 7: 104,141,275 I536T probably benign Het
Vmn1r44 A G 6: 89,893,754 T161A possibly damaging Het
Vmn2r108 T A 17: 20,471,083 I393F possibly damaging Het
Other mutations in Cdh12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01351:Cdh12 APN 15 21237903 missense probably damaging 0.98
IGL01414:Cdh12 APN 15 21492689 missense probably damaging 1.00
IGL02088:Cdh12 APN 15 21480339 nonsense probably null
IGL02894:Cdh12 APN 15 21586294 missense probably damaging 1.00
IGL03008:Cdh12 APN 15 21480330 missense probably damaging 0.98
IGL03271:Cdh12 APN 15 21586453 missense probably benign 0.19
IGL03402:Cdh12 APN 15 21583740 missense probably benign 0.08
R0042:Cdh12 UTSW 15 21537677 splice site probably benign
R0126:Cdh12 UTSW 15 21583945 missense probably benign
R0239:Cdh12 UTSW 15 21586407 missense probably damaging 1.00
R0239:Cdh12 UTSW 15 21586407 missense probably damaging 1.00
R0335:Cdh12 UTSW 15 21578549 critical splice donor site probably null
R0421:Cdh12 UTSW 15 21480224 critical splice acceptor site probably null
R0918:Cdh12 UTSW 15 21492599 missense probably damaging 0.99
R0972:Cdh12 UTSW 15 21237764 missense probably benign 0.27
R1014:Cdh12 UTSW 15 21492620 missense probably damaging 0.97
R1304:Cdh12 UTSW 15 21583937 missense probably benign 0.10
R1677:Cdh12 UTSW 15 21520405 missense probably damaging 0.99
R1735:Cdh12 UTSW 15 21520366 missense probably damaging 1.00
R1916:Cdh12 UTSW 15 21520250 splice site probably null
R1950:Cdh12 UTSW 15 21237879 missense probably damaging 1.00
R2059:Cdh12 UTSW 15 21583740 missense probably benign 0.08
R2157:Cdh12 UTSW 15 21583787 missense possibly damaging 0.84
R2404:Cdh12 UTSW 15 21537634 missense probably damaging 1.00
R3625:Cdh12 UTSW 15 21358756 missense probably damaging 1.00
R3703:Cdh12 UTSW 15 21583826 missense probably damaging 0.97
R3704:Cdh12 UTSW 15 21583826 missense probably damaging 0.97
R3743:Cdh12 UTSW 15 21537659 missense probably damaging 0.98
R3771:Cdh12 UTSW 15 21578554 splice site probably benign
R3780:Cdh12 UTSW 15 21585977 splice site probably null
R4750:Cdh12 UTSW 15 21583808 missense possibly damaging 0.59
R5373:Cdh12 UTSW 15 21583912 missense probably damaging 1.00
R5374:Cdh12 UTSW 15 21583912 missense probably damaging 1.00
R5443:Cdh12 UTSW 15 21237849 missense probably benign 0.01
R5548:Cdh12 UTSW 15 21492654 missense probably damaging 1.00
R5746:Cdh12 UTSW 15 21358724 missense probably null 1.00
R5960:Cdh12 UTSW 15 21492476 splice site probably null
R6248:Cdh12 UTSW 15 21237714 missense possibly damaging 0.82
R6379:Cdh12 UTSW 15 21492657 missense probably benign 0.02
R6419:Cdh12 UTSW 15 21520397 missense probably damaging 0.99
R6561:Cdh12 UTSW 15 21492594 missense probably damaging 1.00
R6901:Cdh12 UTSW 15 21583786 missense probably benign 0.01
R7070:Cdh12 UTSW 15 21583829 missense probably benign 0.38
R7508:Cdh12 UTSW 15 21583765 missense probably benign
R8126:Cdh12 UTSW 15 21558307 missense probably benign 0.02
R8307:Cdh12 UTSW 15 21358863 missense probably benign
R8307:Cdh12 UTSW 15 21358864 missense probably damaging 1.00
X0065:Cdh12 UTSW 15 21358765 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAATTATCCAGCCATCCACATTG -3'
(R):5'- TCACCCACAGGAGACATTTCTG -3'

Sequencing Primer
(F):5'- TTGAAAATCTCAATAACCAGGAAGG -3'
(R):5'- CAGGAGACATTTCTGGAACACTAGC -3'
Posted On2019-05-13