Mutagenetix > Incidental Mutations

Incidental Mutation 'R7025:Cdh12'

545927

Institutional Source

Beutler Lab

Gene Symbol

Cdh12

Ensembl Gene

ENSMUSG00000040452

Gene Name

cadherin 12

Synonyms

Br-cadherin

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.169) question?

Stock #

R7025 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

20449265-21589533 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 21358814 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 108 (T108K)

Ref Sequence

ENSEMBL: ENSMUSP00000153750 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075132] [ENSMUST00000227496]

Predicted Effect

probably damaging
Transcript: ENSMUST00000075132
AA Change: T108K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000074632
Gene: ENSMUSG00000040452
AA Change: T108K

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
CA	77	158	5.18e-18	SMART
CA	182	267	4.4e-30	SMART
CA	291	383	2.42e-18	SMART
CA	406	487	7.55e-20	SMART
CA	510	597	9.3e-2	SMART
transmembrane domain	615	637	N/A	INTRINSIC
Pfam:Cadherin_C	640	784	1.7e-54	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000227496
AA Change: T108K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. This gene is expressed in both the excitatory and inhibitory neurons in various areas of the adult central nervous system including the cerebellum, neocortex, hippocampus and in different subcortical nuclei. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 15. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acbd4	T	A	11: 103,104,538	L90M	probably damaging	Het
Acot7	T	C	4: 152,178,189	S7P	unknown	Het
Ahcyl2	T	C	6: 29,908,421	Y388H	probably damaging	Het
Atp1a2	T	A	1: 172,284,550	R593*	probably null	Het
Bicral	T	C	17: 46,801,668	T869A	probably benign	Het
Brca2	C	T	5: 150,540,478	P1236S	probably benign	Het
Cacna2d1	C	T	5: 16,352,668	Q699*	probably null	Het
Ccser2	T	C	14: 36,940,007	N407D	probably damaging	Het
Cd300lg	A	G	11: 102,043,074	Y49C	probably damaging	Het
Ctnnd1	A	T	2: 84,610,606	I715K	possibly damaging	Het
Cyp17a1	T	A	19: 46,670,980	D137V	probably damaging	Het
Dbr1	A	G	9: 99,575,983	T19A	probably damaging	Het
Dnah3	C	T	7: 120,030,010	A1441T	possibly damaging	Het
Dpt	G	A	1: 164,796,939	D70N	probably damaging	Het
Elk4	C	A	1: 132,019,369	P366Q	probably damaging	Het
Eml4	A	C	17: 83,425,311	D131A	probably benign	Het
Faap24	A	G	7: 35,392,871	I207T	possibly damaging	Het
Fam198b	T	C	3: 79,886,548	Y108H	probably damaging	Het
Fam219a	T	C	4: 41,521,925	S41G	probably benign	Het
Gm15448	T	A	7: 3,821,262	K629*	probably null	Het
Ifi203	T	C	1: 173,928,385		probably benign	Het
Inpp4a	T	C	1: 37,369,423	V295A	probably benign	Het
Kif2a	A	G	13: 106,982,594	Y267H	probably damaging	Het
Kprp	T	A	3: 92,825,197	Q182L	probably benign	Het
Krt90	T	C	15: 101,557,175	K337R	possibly damaging	Het
Lrp2	T	A	2: 69,483,028	Y2453F	possibly damaging	Het
Magel2	A	C	7: 62,379,787	Y813S	unknown	Het
Myh7	C	A	14: 54,974,644	E1548*	probably null	Het
Myh8	A	G	11: 67,297,539	T1009A	probably benign	Het
Nab2	T	A	10: 127,666,508		probably benign	Het
Neb	T	C	2: 52,296,273	D929G	possibly damaging	Het
Nelfb	A	C	2: 25,210,493	V155G	probably damaging	Het
Nmur1	C	A	1: 86,387,848	M65I	possibly damaging	Het
Nop56	C	T	2: 130,277,881	R81*	probably null	Het
Npnt	C	T	3: 132,908,396	C47Y	probably damaging	Het
Nrp1	G	T	8: 128,480,954	C610F	probably damaging	Het
Olfr1175-ps	T	C	2: 88,323,262	K148E	probably damaging	Het
Olfr1243	T	A	2: 89,527,604	I269F	probably damaging	Het
Olfr766-ps1	T	A	10: 129,064,675	M1L	probably benign	Het
Pax5	G	A	4: 44,679,501	Q93*	probably null	Het
Pcnt	G	T	10: 76,403,835	Q1273K	probably damaging	Het
Pde4dip	G	A	3: 97,724,183	Q1137*	probably null	Het
Pfas	A	T	11: 68,990,760	D959E	probably benign	Het
Prex1	TCCGACCCC	TCCGACCCCGACCCC	2: 166,613,187		probably benign	Het
Prpf40b	C	T	15: 99,306,400	Q182*	probably null	Het
Ptk2	G	A	15: 73,221,809	P854S	possibly damaging	Het
Rpe65	A	C	3: 159,622,685	E406A	probably damaging	Het
Serpina3k	A	T	12: 104,341,142	Y211F	probably benign	Het
Shkbp1	T	C	7: 27,355,281	I65V	possibly damaging	Het
Slc22a29	G	A	19: 8,160,580	P544S	probably benign	Het
Stab2	T	C	10: 86,850,837	D2281G	probably damaging	Het
Tjp2	A	G	19: 24,132,688	M64T	probably benign	Het
Tnfrsf8	C	T	4: 145,274,403	V378I	possibly damaging	Het
Trpm1	A	T	7: 64,226,714		probably null	Het
Ubqln3	A	G	7: 104,141,275	I536T	probably benign	Het
Vmn1r44	A	G	6: 89,893,754	T161A	possibly damaging	Het
Vmn2r108	T	A	17: 20,471,083	I393F	possibly damaging	Het

Other mutations in Cdh12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01351:Cdh12	APN	15	21237903	missense	probably damaging	0.98
IGL01414:Cdh12	APN	15	21492689	missense	probably damaging	1.00
IGL02088:Cdh12	APN	15	21480339	nonsense	probably null
IGL02894:Cdh12	APN	15	21586294	missense	probably damaging	1.00
IGL03008:Cdh12	APN	15	21480330	missense	probably damaging	0.98
IGL03271:Cdh12	APN	15	21586453	missense	probably benign	0.19
IGL03402:Cdh12	APN	15	21583740	missense	probably benign	0.08
R0042:Cdh12	UTSW	15	21537677	splice site	probably benign
R0126:Cdh12	UTSW	15	21583945	missense	probably benign
R0239:Cdh12	UTSW	15	21586407	missense	probably damaging	1.00
R0239:Cdh12	UTSW	15	21586407	missense	probably damaging	1.00
R0335:Cdh12	UTSW	15	21578549	critical splice donor site	probably null
R0421:Cdh12	UTSW	15	21480224	critical splice acceptor site	probably null
R0918:Cdh12	UTSW	15	21492599	missense	probably damaging	0.99
R0972:Cdh12	UTSW	15	21237764	missense	probably benign	0.27
R1014:Cdh12	UTSW	15	21492620	missense	probably damaging	0.97
R1304:Cdh12	UTSW	15	21583937	missense	probably benign	0.10
R1677:Cdh12	UTSW	15	21520405	missense	probably damaging	0.99
R1735:Cdh12	UTSW	15	21520366	missense	probably damaging	1.00
R1916:Cdh12	UTSW	15	21520250	splice site	probably null
R1950:Cdh12	UTSW	15	21237879	missense	probably damaging	1.00
R2059:Cdh12	UTSW	15	21583740	missense	probably benign	0.08
R2157:Cdh12	UTSW	15	21583787	missense	possibly damaging	0.84
R2404:Cdh12	UTSW	15	21537634	missense	probably damaging	1.00
R3625:Cdh12	UTSW	15	21358756	missense	probably damaging	1.00
R3703:Cdh12	UTSW	15	21583826	missense	probably damaging	0.97
R3704:Cdh12	UTSW	15	21583826	missense	probably damaging	0.97
R3743:Cdh12	UTSW	15	21537659	missense	probably damaging	0.98
R3771:Cdh12	UTSW	15	21578554	splice site	probably benign
R3780:Cdh12	UTSW	15	21585977	splice site	probably null
R4750:Cdh12	UTSW	15	21583808	missense	possibly damaging	0.59
R5373:Cdh12	UTSW	15	21583912	missense	probably damaging	1.00
R5374:Cdh12	UTSW	15	21583912	missense	probably damaging	1.00
R5443:Cdh12	UTSW	15	21237849	missense	probably benign	0.01
R5548:Cdh12	UTSW	15	21492654	missense	probably damaging	1.00
R5746:Cdh12	UTSW	15	21358724	missense	probably null	1.00
R5960:Cdh12	UTSW	15	21492476	splice site	probably null
R6248:Cdh12	UTSW	15	21237714	missense	possibly damaging	0.82
R6379:Cdh12	UTSW	15	21492657	missense	probably benign	0.02
R6419:Cdh12	UTSW	15	21520397	missense	probably damaging	0.99
R6561:Cdh12	UTSW	15	21492594	missense	probably damaging	1.00
R6901:Cdh12	UTSW	15	21583786	missense	probably benign	0.01
R7070:Cdh12	UTSW	15	21583829	missense	probably benign	0.38
R7508:Cdh12	UTSW	15	21583765	missense	probably benign
R8126:Cdh12	UTSW	15	21558307	missense	probably benign	0.02
R8307:Cdh12	UTSW	15	21358863	missense	probably benign
R8307:Cdh12	UTSW	15	21358864	missense	probably damaging	1.00
X0065:Cdh12	UTSW	15	21358765	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAATTATCCAGCCATCCACATTG -3'
(R):5'- TCACCCACAGGAGACATTTCTG -3'

Sequencing Primer
(F):5'- TTGAAAATCTCAATAACCAGGAAGG -3'
(R):5'- CAGGAGACATTTCTGGAACACTAGC -3'

Posted On

2019-05-13