Mutagenetix > Incidental Mutations

Incidental Mutation 'R7025:Ptk2'

545928

Institutional Source

Beutler Lab

Gene Symbol

Ptk2

Ensembl Gene

ENSMUSG00000022607

Gene Name

PTK2 protein tyrosine kinase 2

Synonyms

FRNK, FAK, Fadk

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7025 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

73205102-73423280 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 73221809 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 854 (P854S)

Ref Sequence

ENSEMBL: ENSMUSP00000105663 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110036] [ENSMUST00000226988]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110036
AA Change: P854S

PolyPhen 2 Score 0.459 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000105663
Gene: ENSMUSG00000022607
AA Change: P854S

Domain	Start	End	E-Value	Type
B41	31	258	1.49e-39	SMART
Blast:B41	288	333	1e-19	BLAST
TyrKc	422	676	1.11e-130	SMART
low complexity region	686	698	N/A	INTRINSIC
low complexity region	712	726	N/A	INTRINSIC
low complexity region	863	883	N/A	INTRINSIC
Pfam:Focal_AT	914	1046	5e-59	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000226988
AA Change: P854S

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)

Meta Mutation Damage Score

0.0739

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein tyrosine kinase which is found concentrated in the focal adhesions that form between cells growing in the presence of extracellular matrix constituents. The encoded protein is a member of the FAK subfamily of protein tyrosine kinases but lacks significant sequence similarity to kinases from other subfamilies. Activation of this gene may be an important early step in cell growth and intracellular signal transduction pathways triggered in response to certain neural peptides or to cell interactions with the extracellular matrix. Several transcript variants encoding different isoforms have been found for this gene, but the full-length natures of only four of them have been determined. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele die before or during organogenesis with growth retardation, abnormal embryonic and extra embryonic tissue development, and abnormal vascular development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acbd4	T	A	11: 103,104,538	L90M	probably damaging	Het
Acot7	T	C	4: 152,178,189	S7P	unknown	Het
Ahcyl2	T	C	6: 29,908,421	Y388H	probably damaging	Het
Atp1a2	T	A	1: 172,284,550	R593*	probably null	Het
Bicral	T	C	17: 46,801,668	T869A	probably benign	Het
Brca2	C	T	5: 150,540,478	P1236S	probably benign	Het
Cacna2d1	C	T	5: 16,352,668	Q699*	probably null	Het
Ccser2	T	C	14: 36,940,007	N407D	probably damaging	Het
Cd300lg	A	G	11: 102,043,074	Y49C	probably damaging	Het
Cdh12	C	A	15: 21,358,814	T108K	probably damaging	Het
Ctnnd1	A	T	2: 84,610,606	I715K	possibly damaging	Het
Cyp17a1	T	A	19: 46,670,980	D137V	probably damaging	Het
Dbr1	A	G	9: 99,575,983	T19A	probably damaging	Het
Dnah3	C	T	7: 120,030,010	A1441T	possibly damaging	Het
Dpt	G	A	1: 164,796,939	D70N	probably damaging	Het
Elk4	C	A	1: 132,019,369	P366Q	probably damaging	Het
Eml4	A	C	17: 83,425,311	D131A	probably benign	Het
Faap24	A	G	7: 35,392,871	I207T	possibly damaging	Het
Fam198b	T	C	3: 79,886,548	Y108H	probably damaging	Het
Fam219a	T	C	4: 41,521,925	S41G	probably benign	Het
Gm15448	T	A	7: 3,821,262	K629*	probably null	Het
Ifi203	T	C	1: 173,928,385		probably benign	Het
Inpp4a	T	C	1: 37,369,423	V295A	probably benign	Het
Kif2a	A	G	13: 106,982,594	Y267H	probably damaging	Het
Kprp	T	A	3: 92,825,197	Q182L	probably benign	Het
Krt90	T	C	15: 101,557,175	K337R	possibly damaging	Het
Lrp2	T	A	2: 69,483,028	Y2453F	possibly damaging	Het
Magel2	A	C	7: 62,379,787	Y813S	unknown	Het
Myh7	C	A	14: 54,974,644	E1548*	probably null	Het
Myh8	A	G	11: 67,297,539	T1009A	probably benign	Het
Nab2	T	A	10: 127,666,508		probably benign	Het
Neb	T	C	2: 52,296,273	D929G	possibly damaging	Het
Nelfb	A	C	2: 25,210,493	V155G	probably damaging	Het
Nmur1	C	A	1: 86,387,848	M65I	possibly damaging	Het
Nop56	C	T	2: 130,277,881	R81*	probably null	Het
Npnt	C	T	3: 132,908,396	C47Y	probably damaging	Het
Nrp1	G	T	8: 128,480,954	C610F	probably damaging	Het
Olfr1175-ps	T	C	2: 88,323,262	K148E	probably damaging	Het
Olfr1243	T	A	2: 89,527,604	I269F	probably damaging	Het
Olfr766-ps1	T	A	10: 129,064,675	M1L	probably benign	Het
Pax5	G	A	4: 44,679,501	Q93*	probably null	Het
Pcnt	G	T	10: 76,403,835	Q1273K	probably damaging	Het
Pde4dip	G	A	3: 97,724,183	Q1137*	probably null	Het
Pfas	A	T	11: 68,990,760	D959E	probably benign	Het
Prex1	TCCGACCCC	TCCGACCCCGACCCC	2: 166,613,187		probably benign	Het
Prpf40b	C	T	15: 99,306,400	Q182*	probably null	Het
Rpe65	A	C	3: 159,622,685	E406A	probably damaging	Het
Serpina3k	A	T	12: 104,341,142	Y211F	probably benign	Het
Shkbp1	T	C	7: 27,355,281	I65V	possibly damaging	Het
Slc22a29	G	A	19: 8,160,580	P544S	probably benign	Het
Stab2	T	C	10: 86,850,837	D2281G	probably damaging	Het
Tjp2	A	G	19: 24,132,688	M64T	probably benign	Het
Tnfrsf8	C	T	4: 145,274,403	V378I	possibly damaging	Het
Trpm1	A	T	7: 64,226,714		probably null	Het
Ubqln3	A	G	7: 104,141,275	I536T	probably benign	Het
Vmn1r44	A	G	6: 89,893,754	T161A	possibly damaging	Het
Vmn2r108	T	A	17: 20,471,083	I393F	possibly damaging	Het

Other mutations in Ptk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00861:Ptk2	APN	15	73262547	missense	probably damaging	1.00
IGL00913:Ptk2	APN	15	73295389	splice site	probably benign
IGL01605:Ptk2	APN	15	73264339	splice site	probably benign
IGL01631:Ptk2	APN	15	73216371	missense	probably damaging	1.00
IGL01952:Ptk2	APN	15	73229931	missense	probably damaging	0.99
IGL01957:Ptk2	APN	15	73242473	missense	probably benign	0.05
IGL02441:Ptk2	APN	15	73320826	missense	probably benign	0.16
IGL02471:Ptk2	APN	15	73298187	missense	probably benign	0.41
IGL02621:Ptk2	APN	15	73206145	missense	probably damaging	0.99
IGL03198:Ptk2	APN	15	73236216	missense	probably damaging	1.00
Shooter	UTSW	15	73304444	missense	possibly damaging	0.83
R0239:Ptk2	UTSW	15	73343283	splice site	probably null
R0239:Ptk2	UTSW	15	73343283	splice site	probably null
R1254:Ptk2	UTSW	15	73229970	missense	probably benign	0.01
R1291:Ptk2	UTSW	15	73210756	missense	probably damaging	1.00
R1307:Ptk2	UTSW	15	73292046	missense	probably benign	0.01
R1608:Ptk2	UTSW	15	73262575	missense	probably damaging	0.98
R1690:Ptk2	UTSW	15	73262610	missense	probably damaging	1.00
R1724:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R1725:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R1740:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R1741:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R1840:Ptk2	UTSW	15	73210884	missense	probably damaging	1.00
R1956:Ptk2	UTSW	15	73215983	missense	possibly damaging	0.49
R2022:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R2092:Ptk2	UTSW	15	73236191	nonsense	probably null
R2114:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R2115:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R2336:Ptk2	UTSW	15	73266116	missense	probably damaging	1.00
R2571:Ptk2	UTSW	15	73231919	missense	probably damaging	1.00
R4232:Ptk2	UTSW	15	73309849	missense	possibly damaging	0.61
R4245:Ptk2	UTSW	15	73231976	missense	probably benign	0.00
R4594:Ptk2	UTSW	15	73206196	missense	probably damaging	1.00
R4688:Ptk2	UTSW	15	73206225	missense	probably damaging	1.00
R4834:Ptk2	UTSW	15	73216096	splice site	probably null
R4847:Ptk2	UTSW	15	73231956	missense	probably benign
R5558:Ptk2	UTSW	15	73304445	missense	probably damaging	0.97
R5682:Ptk2	UTSW	15	73262564	nonsense	probably null
R5858:Ptk2	UTSW	15	73321095	missense	probably benign	0.12
R5951:Ptk2	UTSW	15	73303833	missense	possibly damaging	0.88
R6014:Ptk2	UTSW	15	73304444	missense	possibly damaging	0.83
R6027:Ptk2	UTSW	15	73229913	missense	probably damaging	1.00
R6082:Ptk2	UTSW	15	73276865	missense	probably damaging	1.00
R7031:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7032:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7077:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7078:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7079:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7090:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7091:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7092:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7136:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7137:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7798:Ptk2	UTSW	15	73295375	missense	probably damaging	1.00
R8057:Ptk2	UTSW	15	73298199	frame shift	probably null
R8235:Ptk2	UTSW	15	73343291	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GGACAGTGATCTGCATCTATGAAAATC -3'
(R):5'- TTGGGAGCAGTGTCACAGTG -3'

Sequencing Primer
(F):5'- GCATCTATGAAAATCTGGAACATGGC -3'
(R):5'- ACACTGAGATGATGTTGGGTAC -3'

Posted On

2019-05-13