Mutagenetix > Incidental Mutations

Incidental Mutation 'R7025:Eml4'

545933

Institutional Source

Beutler Lab

Gene Symbol

Eml4

Ensembl Gene

ENSMUSG00000032624

Gene Name

echinoderm microtubule associated protein like 4

Synonyms

4930443C24Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.902) question?

Stock #

R7025 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

83350931-83480361 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 83425311 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Alanine at position 131 (D131A)

Ref Sequence

ENSEMBL: ENSMUSP00000094528 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049503] [ENSMUST00000096766] [ENSMUST00000112363]

Predicted Effect

probably benign
Transcript: ENSMUST00000049503

SMART Domains

Protein: ENSMUSP00000041880
Gene: ENSMUSG00000032624

Domain	Start	End	E-Value	Type
coiled coil region	15	53	N/A	INTRINSIC
WD40	197	246	1.79e-1	SMART
Blast:WD40	252	294	3e-19	BLAST
WD40	297	336	5.97e-1	SMART
WD40	345	382	2.96e1	SMART
low complexity region	388	396	N/A	INTRINSIC
WD40	397	436	1.48e-2	SMART
WD40	480	519	4.95e-4	SMART
WD40	522	560	7.92e1	SMART
WD40	563	602	5.75e-1	SMART
WD40	609	648	2.69e-5	SMART
WD40	722	762	8.04e-4	SMART
low complexity region	793	805	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000096766
AA Change: D131A

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000094528
Gene: ENSMUSG00000032624
AA Change: D131A

Domain	Start	End	E-Value	Type
coiled coil region	15	53	N/A	INTRINSIC
low complexity region	137	155	N/A	INTRINSIC
Pfam:HELP	236	308	1.1e-33	PFAM
WD40	309	358	1.79e-1	SMART
Blast:WD40	364	406	4e-20	BLAST
WD40	409	448	5.97e-1	SMART
WD40	457	494	2.96e1	SMART
low complexity region	500	508	N/A	INTRINSIC
WD40	509	548	1.48e-2	SMART
WD40	592	631	4.95e-4	SMART
WD40	634	672	7.92e1	SMART
WD40	675	714	5.75e-1	SMART
WD40	721	760	2.69e-5	SMART
WD40	834	874	8.04e-4	SMART
low complexity region	905	917	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112363

SMART Domains

Protein: ENSMUSP00000107982
Gene: ENSMUSG00000032624

Domain	Start	End	E-Value	Type
coiled coil region	15	53	N/A	INTRINSIC
WD40	240	289	1.79e-1	SMART
Blast:WD40	295	337	3e-19	BLAST
WD40	340	379	5.97e-1	SMART
WD40	388	425	2.96e1	SMART
low complexity region	431	439	N/A	INTRINSIC
WD40	440	479	1.48e-2	SMART
WD40	523	562	4.95e-4	SMART
WD40	565	603	7.92e1	SMART
WD40	606	645	5.75e-1	SMART
WD40	652	691	2.69e-5	SMART
WD40	765	805	8.04e-4	SMART
low complexity region	836	848	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the echinoderm microtubule associated protein-like family. The encoded WD-repeat protein may be involved in microtubule formation. Abnormal fusion of parts of this gene with portions of the anaplastic lymphoma receptor tyrosine kinase gene, which generates EML4-ALK fusion transcripts, is one of the primary mutations associated with non-small cell lung cancer. Alternative splicing of this gene results in two transcript variants. [provided by RefSeq, Jan 2015]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acbd4	T	A	11: 103,104,538	L90M	probably damaging	Het
Acot7	T	C	4: 152,178,189	S7P	unknown	Het
Ahcyl2	T	C	6: 29,908,421	Y388H	probably damaging	Het
Atp1a2	T	A	1: 172,284,550	R593*	probably null	Het
Bicral	T	C	17: 46,801,668	T869A	probably benign	Het
Brca2	C	T	5: 150,540,478	P1236S	probably benign	Het
Cacna2d1	C	T	5: 16,352,668	Q699*	probably null	Het
Ccser2	T	C	14: 36,940,007	N407D	probably damaging	Het
Cd300lg	A	G	11: 102,043,074	Y49C	probably damaging	Het
Cdh12	C	A	15: 21,358,814	T108K	probably damaging	Het
Ctnnd1	A	T	2: 84,610,606	I715K	possibly damaging	Het
Cyp17a1	T	A	19: 46,670,980	D137V	probably damaging	Het
Dbr1	A	G	9: 99,575,983	T19A	probably damaging	Het
Dnah3	C	T	7: 120,030,010	A1441T	possibly damaging	Het
Dpt	G	A	1: 164,796,939	D70N	probably damaging	Het
Elk4	C	A	1: 132,019,369	P366Q	probably damaging	Het
Faap24	A	G	7: 35,392,871	I207T	possibly damaging	Het
Fam198b	T	C	3: 79,886,548	Y108H	probably damaging	Het
Fam219a	T	C	4: 41,521,925	S41G	probably benign	Het
Gm15448	T	A	7: 3,821,262	K629*	probably null	Het
Ifi203	T	C	1: 173,928,385		probably benign	Het
Inpp4a	T	C	1: 37,369,423	V295A	probably benign	Het
Kif2a	A	G	13: 106,982,594	Y267H	probably damaging	Het
Kprp	T	A	3: 92,825,197	Q182L	probably benign	Het
Krt90	T	C	15: 101,557,175	K337R	possibly damaging	Het
Lrp2	T	A	2: 69,483,028	Y2453F	possibly damaging	Het
Magel2	A	C	7: 62,379,787	Y813S	unknown	Het
Myh7	C	A	14: 54,974,644	E1548*	probably null	Het
Myh8	A	G	11: 67,297,539	T1009A	probably benign	Het
Nab2	T	A	10: 127,666,508		probably benign	Het
Neb	T	C	2: 52,296,273	D929G	possibly damaging	Het
Nelfb	A	C	2: 25,210,493	V155G	probably damaging	Het
Nmur1	C	A	1: 86,387,848	M65I	possibly damaging	Het
Nop56	C	T	2: 130,277,881	R81*	probably null	Het
Npnt	C	T	3: 132,908,396	C47Y	probably damaging	Het
Nrp1	G	T	8: 128,480,954	C610F	probably damaging	Het
Olfr1175-ps	T	C	2: 88,323,262	K148E	probably damaging	Het
Olfr1243	T	A	2: 89,527,604	I269F	probably damaging	Het
Olfr766-ps1	T	A	10: 129,064,675	M1L	probably benign	Het
Pax5	G	A	4: 44,679,501	Q93*	probably null	Het
Pcnt	G	T	10: 76,403,835	Q1273K	probably damaging	Het
Pde4dip	G	A	3: 97,724,183	Q1137*	probably null	Het
Pfas	A	T	11: 68,990,760	D959E	probably benign	Het
Prex1	TCCGACCCC	TCCGACCCCGACCCC	2: 166,613,187		probably benign	Het
Prpf40b	C	T	15: 99,306,400	Q182*	probably null	Het
Ptk2	G	A	15: 73,221,809	P854S	possibly damaging	Het
Rpe65	A	C	3: 159,622,685	E406A	probably damaging	Het
Serpina3k	A	T	12: 104,341,142	Y211F	probably benign	Het
Shkbp1	T	C	7: 27,355,281	I65V	possibly damaging	Het
Slc22a29	G	A	19: 8,160,580	P544S	probably benign	Het
Stab2	T	C	10: 86,850,837	D2281G	probably damaging	Het
Tjp2	A	G	19: 24,132,688	M64T	probably benign	Het
Tnfrsf8	C	T	4: 145,274,403	V378I	possibly damaging	Het
Trpm1	A	T	7: 64,226,714		probably null	Het
Ubqln3	A	G	7: 104,141,275	I536T	probably benign	Het
Vmn1r44	A	G	6: 89,893,754	T161A	possibly damaging	Het
Vmn2r108	T	A	17: 20,471,083	I393F	possibly damaging	Het

Other mutations in Eml4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00718:Eml4	APN	17	83448184	missense	probably benign	0.05
IGL00815:Eml4	APN	17	83450790	splice site	probably benign
IGL01969:Eml4	APN	17	83445980	missense	possibly damaging	0.95
IGL02005:Eml4	APN	17	83477703	splice site	probably benign
IGL02273:Eml4	APN	17	83456379	splice site	probably null
IGL02318:Eml4	APN	17	83441366	missense	probably benign	0.01
IGL02421:Eml4	APN	17	83477892	missense	probably benign	0.00
IGL02728:Eml4	APN	17	83473139	splice site	probably null
IGL02814:Eml4	APN	17	83441362	nonsense	probably null
IGL02900:Eml4	APN	17	83477992	missense	probably benign	0.00
IGL03205:Eml4	APN	17	83454444	missense	probably damaging	1.00
erring	UTSW	17	83448217	missense	probably damaging	1.00
R0147:Eml4	UTSW	17	83421652	missense	probably damaging	1.00
R0148:Eml4	UTSW	17	83421652	missense	probably damaging	1.00
R0440:Eml4	UTSW	17	83446058	critical splice donor site	probably null
R0541:Eml4	UTSW	17	83440042	missense	probably benign	0.00
R0645:Eml4	UTSW	17	83463493	splice site	probably benign
R0733:Eml4	UTSW	17	83454464	missense	possibly damaging	0.88
R0944:Eml4	UTSW	17	83478060	missense	probably benign	0.08
R1071:Eml4	UTSW	17	83478039	nonsense	probably null
R1975:Eml4	UTSW	17	83410193	missense	probably benign	0.00
R2042:Eml4	UTSW	17	83448178	missense	probably damaging	0.97
R2229:Eml4	UTSW	17	83451056	missense	probably benign	0.05
R2257:Eml4	UTSW	17	83477760	missense	probably damaging	0.99
R2878:Eml4	UTSW	17	83410174	missense	probably benign	0.01
R3820:Eml4	UTSW	17	83473065	missense	probably damaging	1.00
R4466:Eml4	UTSW	17	83421674	nonsense	probably null
R4620:Eml4	UTSW	17	83461533	missense	probably benign	0.13
R4657:Eml4	UTSW	17	83450948	nonsense	probably null
R4717:Eml4	UTSW	17	83448225	missense	probably benign	0.38
R4740:Eml4	UTSW	17	83410030	missense	probably damaging	1.00
R5073:Eml4	UTSW	17	83463577	missense	probably damaging	1.00
R5699:Eml4	UTSW	17	83410085	missense	probably benign	0.16
R5834:Eml4	UTSW	17	83477741	missense	probably damaging	1.00
R5944:Eml4	UTSW	17	83446043	missense	possibly damaging	0.52
R6044:Eml4	UTSW	17	83445950	missense	probably damaging	1.00
R6378:Eml4	UTSW	17	83448217	missense	probably damaging	1.00
R6980:Eml4	UTSW	17	83451017	missense	probably benign	0.00
R7037:Eml4	UTSW	17	83425327	missense	probably benign	0.04
R7042:Eml4	UTSW	17	83461570	missense	probably damaging	0.99
R7192:Eml4	UTSW	17	83454461	missense	probably benign	0.01
R7525:Eml4	UTSW	17	83445950	missense	probably damaging	1.00
R7548:Eml4	UTSW	17	83425337	missense	probably benign	0.18
R7595:Eml4	UTSW	17	83456084	missense	probably benign	0.18
R7791:Eml4	UTSW	17	83473706	missense	probably benign	0.45
R7866:Eml4	UTSW	17	83450697	missense	probably benign	0.00
R7936:Eml4	UTSW	17	83473686	missense	possibly damaging	0.65
R8435:Eml4	UTSW	17	83421641	missense	possibly damaging	0.78
R8447:Eml4	UTSW	17	83448227	missense	probably damaging	0.99
Z1176:Eml4	UTSW	17	83445965	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCACTAGAGGTCACTTCTGTCC -3'
(R):5'- CTTGCCAAATCACAGAATCTAGG -3'

Sequencing Primer
(F):5'- GAGGTCACTTCTGTCCAAAAAG -3'
(R):5'- AGGTATCTTTACAACCATTCCCTAG -3'

Posted On

2019-05-13