Incidental Mutation 'R7025:Slc22a29'
ID545934
Institutional Source Beutler Lab
Gene Symbol Slc22a29
Ensembl Gene ENSMUSG00000075044
Gene Namesolute carrier family 22. member 29
SynonymsD630002G06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7025 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location8160165-8218900 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 8160580 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 544 (P544S)
Ref Sequence ENSEMBL: ENSMUSP00000108923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113298] [ENSMUST00000222533]
Predicted Effect probably benign
Transcript: ENSMUST00000113298
AA Change: P544S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108923
Gene: ENSMUSG00000075044
AA Change: P544S

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Sugar_tr 99 528 1.3e-25 PFAM
Pfam:MFS_1 140 372 7.7e-14 PFAM
Pfam:MFS_1 348 549 6.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000222533
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd4 T A 11: 103,104,538 L90M probably damaging Het
Acot7 T C 4: 152,178,189 S7P unknown Het
Ahcyl2 T C 6: 29,908,421 Y388H probably damaging Het
Atp1a2 T A 1: 172,284,550 R593* probably null Het
Bicral T C 17: 46,801,668 T869A probably benign Het
Brca2 C T 5: 150,540,478 P1236S probably benign Het
Cacna2d1 C T 5: 16,352,668 Q699* probably null Het
Ccser2 T C 14: 36,940,007 N407D probably damaging Het
Cd300lg A G 11: 102,043,074 Y49C probably damaging Het
Cdh12 C A 15: 21,358,814 T108K probably damaging Het
Ctnnd1 A T 2: 84,610,606 I715K possibly damaging Het
Cyp17a1 T A 19: 46,670,980 D137V probably damaging Het
Dbr1 A G 9: 99,575,983 T19A probably damaging Het
Dnah3 C T 7: 120,030,010 A1441T possibly damaging Het
Dpt G A 1: 164,796,939 D70N probably damaging Het
Elk4 C A 1: 132,019,369 P366Q probably damaging Het
Eml4 A C 17: 83,425,311 D131A probably benign Het
Faap24 A G 7: 35,392,871 I207T possibly damaging Het
Fam198b T C 3: 79,886,548 Y108H probably damaging Het
Fam219a T C 4: 41,521,925 S41G probably benign Het
Gm15448 T A 7: 3,821,262 K629* probably null Het
Ifi203 T C 1: 173,928,385 probably benign Het
Inpp4a T C 1: 37,369,423 V295A probably benign Het
Kif2a A G 13: 106,982,594 Y267H probably damaging Het
Kprp T A 3: 92,825,197 Q182L probably benign Het
Krt90 T C 15: 101,557,175 K337R possibly damaging Het
Lrp2 T A 2: 69,483,028 Y2453F possibly damaging Het
Magel2 A C 7: 62,379,787 Y813S unknown Het
Myh7 C A 14: 54,974,644 E1548* probably null Het
Myh8 A G 11: 67,297,539 T1009A probably benign Het
Nab2 T A 10: 127,666,508 probably benign Het
Neb T C 2: 52,296,273 D929G possibly damaging Het
Nelfb A C 2: 25,210,493 V155G probably damaging Het
Nmur1 C A 1: 86,387,848 M65I possibly damaging Het
Nop56 C T 2: 130,277,881 R81* probably null Het
Npnt C T 3: 132,908,396 C47Y probably damaging Het
Nrp1 G T 8: 128,480,954 C610F probably damaging Het
Olfr1175-ps T C 2: 88,323,262 K148E probably damaging Het
Olfr1243 T A 2: 89,527,604 I269F probably damaging Het
Olfr766-ps1 T A 10: 129,064,675 M1L probably benign Het
Pax5 G A 4: 44,679,501 Q93* probably null Het
Pcnt G T 10: 76,403,835 Q1273K probably damaging Het
Pde4dip G A 3: 97,724,183 Q1137* probably null Het
Pfas A T 11: 68,990,760 D959E probably benign Het
Prex1 TCCGACCCC TCCGACCCCGACCCC 2: 166,613,187 probably benign Het
Prpf40b C T 15: 99,306,400 Q182* probably null Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rpe65 A C 3: 159,622,685 E406A probably damaging Het
Serpina3k A T 12: 104,341,142 Y211F probably benign Het
Shkbp1 T C 7: 27,355,281 I65V possibly damaging Het
Stab2 T C 10: 86,850,837 D2281G probably damaging Het
Tjp2 A G 19: 24,132,688 M64T probably benign Het
Tnfrsf8 C T 4: 145,274,403 V378I possibly damaging Het
Trpm1 A T 7: 64,226,714 probably null Het
Ubqln3 A G 7: 104,141,275 I536T probably benign Het
Vmn1r44 A G 6: 89,893,754 T161A possibly damaging Het
Vmn2r108 T A 17: 20,471,083 I393F possibly damaging Het
Other mutations in Slc22a29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Slc22a29 APN 19 8217813 missense probably benign 0.44
IGL00562:Slc22a29 APN 19 8161629 missense probably benign 0.03
IGL00563:Slc22a29 APN 19 8161629 missense probably benign 0.03
IGL00952:Slc22a29 APN 19 8217857 missense probably damaging 1.00
IGL01526:Slc22a29 APN 19 8207178 splice site probably benign
IGL01792:Slc22a29 APN 19 8218529 missense probably damaging 1.00
IGL02191:Slc22a29 APN 19 8218681 unclassified probably benign
IGL02391:Slc22a29 APN 19 8169353 missense probably benign 0.13
IGL02408:Slc22a29 APN 19 8207285 missense probably benign 0.00
IGL02957:Slc22a29 APN 19 8169990 missense probably benign 0.01
IGL03059:Slc22a29 APN 19 8169990 missense probably benign 0.01
IGL03299:Slc22a29 APN 19 8162648 critical splice donor site probably null
IGL03368:Slc22a29 APN 19 8207262 critical splice donor site probably null
R0017:Slc22a29 UTSW 19 8218266 splice site probably benign
R0105:Slc22a29 UTSW 19 8160627 unclassified probably benign
R0157:Slc22a29 UTSW 19 8162742 missense possibly damaging 0.61
R0265:Slc22a29 UTSW 19 8169970 missense probably benign 0.18
R1758:Slc22a29 UTSW 19 8217762 critical splice donor site probably null
R1918:Slc22a29 UTSW 19 8217759 splice site probably null
R1927:Slc22a29 UTSW 19 8207066 missense probably benign 0.01
R1959:Slc22a29 UTSW 19 8169193 missense probably benign 0.05
R1960:Slc22a29 UTSW 19 8169193 missense probably benign 0.05
R1961:Slc22a29 UTSW 19 8169193 missense probably benign 0.05
R1966:Slc22a29 UTSW 19 8218408 missense probably damaging 1.00
R1968:Slc22a29 UTSW 19 8218343 missense probably benign 0.27
R1997:Slc22a29 UTSW 19 8217798 missense probably benign 0.00
R3105:Slc22a29 UTSW 19 8169973 missense probably benign 0.25
R3725:Slc22a29 UTSW 19 8218609 missense possibly damaging 0.78
R4118:Slc22a29 UTSW 19 8160529 unclassified probably benign
R4465:Slc22a29 UTSW 19 8162724 nonsense probably null
R4584:Slc22a29 UTSW 19 8169291 missense probably benign 0.02
R4656:Slc22a29 UTSW 19 8218300 missense possibly damaging 0.90
R4679:Slc22a29 UTSW 19 8161584 missense possibly damaging 0.65
R4899:Slc22a29 UTSW 19 8161569 missense probably benign 0.00
R4913:Slc22a29 UTSW 19 8218358 missense probably benign 0.17
R5119:Slc22a29 UTSW 19 8217830 missense probably damaging 0.99
R5470:Slc22a29 UTSW 19 8161516 missense probably benign 0.01
R5474:Slc22a29 UTSW 19 8217857 missense probably damaging 1.00
R6794:Slc22a29 UTSW 19 8161523 missense probably benign 0.06
R6798:Slc22a29 UTSW 19 8160604 missense probably benign 0.16
R7240:Slc22a29 UTSW 19 8161511 missense probably damaging 0.98
R7535:Slc22a29 UTSW 19 8169978 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGCAATTCCTATGTGATCAG -3'
(R):5'- TTGGTAATCCCCTAATGACCAACATAG -3'

Sequencing Primer
(F):5'- CAGCAATTCCTATGTGATCAGTTTTC -3'
(R):5'- TTTACCAAAATCCTCCAGAAGTAGTC -3'
Posted On2019-05-13