Mutagenetix > Incidental Mutations

Incidental Mutation 'R7025:Tjp2'

545935

Institutional Source

Beutler Lab

Gene Symbol

Tjp2

Ensembl Gene

ENSMUSG00000024812

Gene Name

tight junction protein 2

Synonyms

ZO-2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7025 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

24094523-24225026 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 24132688 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 64 (M64T)

Ref Sequence

ENSEMBL: ENSMUSP00000097154 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099558]

PDB Structure

Solution structure of N-terminal PDZ domain from mouse TJP2 [SOLUTION NMR]

Predicted Effect

probably benign
Transcript: ENSMUST00000099558
AA Change: M64T

PolyPhen 2 Score 0.285 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000097154
Gene: ENSMUSG00000024812
AA Change: M64T

Domain	Start	End	E-Value	Type
PDZ	19	97	1.25e-15	SMART
low complexity region	163	178	N/A	INTRINSIC
low complexity region	181	202	N/A	INTRINSIC
low complexity region	209	226	N/A	INTRINSIC
low complexity region	253	276	N/A	INTRINSIC
PDZ	297	365	8.73e-15	SMART
low complexity region	377	390	N/A	INTRINSIC
PDZ	499	572	1.57e-16	SMART
SH3	587	648	1.07e-2	SMART
GuKc	672	861	3.25e-42	SMART
low complexity region	969	980	N/A	INTRINSIC
low complexity region	1037	1049	N/A	INTRINSIC
coiled coil region	1063	1090	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zonula occluden that is a member of the membrane-associated guanylate kinase homolog family. The encoded protein functions as a component of the tight junction barrier in epithelial and endothelial cells and is necessary for proper assembly of tight junctions. Mutations in this gene have been identified in patients with hypercholanemia, and genomic duplication of a 270 kb region including this gene causes autosomal dominant deafness-51. Alternatively spliced transcripts encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous mutation of this gene results in lethality shortly after implantation due to arrest in early gastrulation. Structure and permeability barrier of the apical junctional complex are altered in cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acbd4	T	A	11: 103,104,538	L90M	probably damaging	Het
Acot7	T	C	4: 152,178,189	S7P	unknown	Het
Ahcyl2	T	C	6: 29,908,421	Y388H	probably damaging	Het
Atp1a2	T	A	1: 172,284,550	R593*	probably null	Het
Bicral	T	C	17: 46,801,668	T869A	probably benign	Het
Brca2	C	T	5: 150,540,478	P1236S	probably benign	Het
Cacna2d1	C	T	5: 16,352,668	Q699*	probably null	Het
Ccser2	T	C	14: 36,940,007	N407D	probably damaging	Het
Cd300lg	A	G	11: 102,043,074	Y49C	probably damaging	Het
Cdh12	C	A	15: 21,358,814	T108K	probably damaging	Het
Ctnnd1	A	T	2: 84,610,606	I715K	possibly damaging	Het
Cyp17a1	T	A	19: 46,670,980	D137V	probably damaging	Het
Dbr1	A	G	9: 99,575,983	T19A	probably damaging	Het
Dnah3	C	T	7: 120,030,010	A1441T	possibly damaging	Het
Dpt	G	A	1: 164,796,939	D70N	probably damaging	Het
Elk4	C	A	1: 132,019,369	P366Q	probably damaging	Het
Eml4	A	C	17: 83,425,311	D131A	probably benign	Het
Faap24	A	G	7: 35,392,871	I207T	possibly damaging	Het
Fam198b	T	C	3: 79,886,548	Y108H	probably damaging	Het
Fam219a	T	C	4: 41,521,925	S41G	probably benign	Het
Gm15448	T	A	7: 3,821,262	K629*	probably null	Het
Ifi203	T	C	1: 173,928,385		probably benign	Het
Inpp4a	T	C	1: 37,369,423	V295A	probably benign	Het
Kif2a	A	G	13: 106,982,594	Y267H	probably damaging	Het
Kprp	T	A	3: 92,825,197	Q182L	probably benign	Het
Krt90	T	C	15: 101,557,175	K337R	possibly damaging	Het
Lrp2	T	A	2: 69,483,028	Y2453F	possibly damaging	Het
Magel2	A	C	7: 62,379,787	Y813S	unknown	Het
Myh7	C	A	14: 54,974,644	E1548*	probably null	Het
Myh8	A	G	11: 67,297,539	T1009A	probably benign	Het
Nab2	T	A	10: 127,666,508		probably benign	Het
Neb	T	C	2: 52,296,273	D929G	possibly damaging	Het
Nelfb	A	C	2: 25,210,493	V155G	probably damaging	Het
Nmur1	C	A	1: 86,387,848	M65I	possibly damaging	Het
Nop56	C	T	2: 130,277,881	R81*	probably null	Het
Npnt	C	T	3: 132,908,396	C47Y	probably damaging	Het
Nrp1	G	T	8: 128,480,954	C610F	probably damaging	Het
Olfr1175-ps	T	C	2: 88,323,262	K148E	probably damaging	Het
Olfr1243	T	A	2: 89,527,604	I269F	probably damaging	Het
Olfr766-ps1	T	A	10: 129,064,675	M1L	probably benign	Het
Pax5	G	A	4: 44,679,501	Q93*	probably null	Het
Pcnt	G	T	10: 76,403,835	Q1273K	probably damaging	Het
Pde4dip	G	A	3: 97,724,183	Q1137*	probably null	Het
Pfas	A	T	11: 68,990,760	D959E	probably benign	Het
Prex1	TCCGACCCC	TCCGACCCCGACCCC	2: 166,613,187		probably benign	Het
Prpf40b	C	T	15: 99,306,400	Q182*	probably null	Het
Ptk2	G	A	15: 73,221,809	P854S	possibly damaging	Het
Rpe65	A	C	3: 159,622,685	E406A	probably damaging	Het
Serpina3k	A	T	12: 104,341,142	Y211F	probably benign	Het
Shkbp1	T	C	7: 27,355,281	I65V	possibly damaging	Het
Slc22a29	G	A	19: 8,160,580	P544S	probably benign	Het
Stab2	T	C	10: 86,850,837	D2281G	probably damaging	Het
Tnfrsf8	C	T	4: 145,274,403	V378I	possibly damaging	Het
Trpm1	A	T	7: 64,226,714		probably null	Het
Ubqln3	A	G	7: 104,141,275	I536T	probably benign	Het
Vmn1r44	A	G	6: 89,893,754	T161A	possibly damaging	Het
Vmn2r108	T	A	17: 20,471,083	I393F	possibly damaging	Het

Other mutations in Tjp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01151:Tjp2	APN	19	24138810	missense	possibly damaging	0.89
IGL01412:Tjp2	APN	19	24100775	missense	probably damaging	0.99
IGL01681:Tjp2	APN	19	24134849	critical splice donor site	probably null
IGL02044:Tjp2	APN	19	24120840	missense	probably damaging	1.00
IGL02212:Tjp2	APN	19	24138786	missense	probably damaging	1.00
IGL02629:Tjp2	APN	19	24122379	splice site	probably benign
IGL02819:Tjp2	APN	19	24114105	missense	probably damaging	0.98
IGL02931:Tjp2	APN	19	24096632	missense	probably benign	0.11
PIT4402001:Tjp2	UTSW	19	24098129	nonsense	probably null
R0032:Tjp2	UTSW	19	24108695	missense	probably damaging	1.00
R0667:Tjp2	UTSW	19	24108749	missense	probably benign	0.36
R0674:Tjp2	UTSW	19	24131316	missense	probably benign	0.37
R0749:Tjp2	UTSW	19	24122272	missense	possibly damaging	0.67
R1185:Tjp2	UTSW	19	24131163	missense	possibly damaging	0.67
R1185:Tjp2	UTSW	19	24131163	missense	possibly damaging	0.67
R1185:Tjp2	UTSW	19	24131163	missense	possibly damaging	0.67
R1563:Tjp2	UTSW	19	24132703	missense	probably damaging	0.99
R1571:Tjp2	UTSW	19	24100875	missense	probably damaging	1.00
R1624:Tjp2	UTSW	19	24131412	missense	probably benign	0.01
R1658:Tjp2	UTSW	19	24112947	missense	probably damaging	0.99
R1851:Tjp2	UTSW	19	24099535	missense	possibly damaging	0.67
R1968:Tjp2	UTSW	19	24111073	missense	probably damaging	0.99
R2068:Tjp2	UTSW	19	24122323	missense	probably benign	0.22
R2273:Tjp2	UTSW	19	24112807	missense	probably benign
R2994:Tjp2	UTSW	19	24112851	missense	probably damaging	1.00
R3767:Tjp2	UTSW	19	24100826	missense	probably benign	0.01
R3770:Tjp2	UTSW	19	24100826	missense	probably benign	0.01
R4077:Tjp2	UTSW	19	24108818	missense	possibly damaging	0.90
R4079:Tjp2	UTSW	19	24108818	missense	possibly damaging	0.90
R4505:Tjp2	UTSW	19	24108831	missense	possibly damaging	0.50
R4720:Tjp2	UTSW	19	24100805	missense	probably damaging	1.00
R4739:Tjp2	UTSW	19	24120111	splice site	probably null
R4745:Tjp2	UTSW	19	24096666	missense	possibly damaging	0.56
R4858:Tjp2	UTSW	19	24122120	missense	probably damaging	1.00
R5290:Tjp2	UTSW	19	24131204	missense	probably benign
R5887:Tjp2	UTSW	19	24096599	missense	probably benign
R5988:Tjp2	UTSW	19	24114100	missense	probably benign
R6144:Tjp2	UTSW	19	24120073	missense	probably damaging	0.99
R6163:Tjp2	UTSW	19	24125704	critical splice donor site	probably null
R6183:Tjp2	UTSW	19	24100791	missense	probably damaging	0.99
R6242:Tjp2	UTSW	19	24099603	splice site	probably null
R6683:Tjp2	UTSW	19	24120843	missense	probably damaging	0.99
R6866:Tjp2	UTSW	19	24101991	missense	probably damaging	0.99
R7153:Tjp2	UTSW	19	24101981	missense	probably benign	0.40
R7514:Tjp2	UTSW	19	24111522	missense	probably benign	0.03
R8004:Tjp2	UTSW	19	24114120	missense	probably damaging	1.00
R8505:Tjp2	UTSW	19	24111074	missense	probably null	1.00
R8527:Tjp2	UTSW	19	24111573	missense	probably damaging	0.99
X0066:Tjp2	UTSW	19	24098027	missense	probably damaging	1.00
Z1176:Tjp2	UTSW	19	24131365	missense	probably benign	0.00
Z1177:Tjp2	UTSW	19	24095460	missense	possibly damaging	0.74

Predicted Primers

PCR Primer
(F):5'- AGCGGCTATTTTCTTTGGACAC -3'
(R):5'- GGTTTCTTACCTCTGAAGAGCTC -3'

Sequencing Primer
(F):5'- TCCTCTGCAAGAACGATATGGGC -3'
(R):5'- TCTCAGACCAAGTTGGCATG -3'

Posted On

2019-05-13