Incidental Mutation 'R7025:Cyp17a1'
ID545936
Institutional Source Beutler Lab
Gene Symbol Cyp17a1
Ensembl Gene ENSMUSG00000003555
Gene Namecytochrome P450, family 17, subfamily a, polypeptide 1
Synonymssteroid 17-alpha hydroxylase, p450c17, Cyp17
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.249) question?
Stock #R7025 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location46667165-46672974 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 46670980 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 137 (D137V)
Ref Sequence ENSEMBL: ENSMUSP00000026012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026012]
Predicted Effect probably damaging
Transcript: ENSMUST00000026012
AA Change: D137V

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000026012
Gene: ENSMUSG00000003555
AA Change: D137V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:p450 28 492 2.6e-140 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. It has both 17alpha-hydroxylase and 17,20-lyase activities and is a key enzyme in the steroidogenic pathway that produces progestins, mineralocorticoids, glucocorticoids, androgens, and estrogens. Mutations in this gene are associated with isolated steroid-17 alpha-hydroxylase deficiency, 17-alpha-hydroxylase/17,20-lyase deficiency, pseudohermaphroditism, and adrenal hyperplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos display early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd4 T A 11: 103,104,538 L90M probably damaging Het
Acot7 T C 4: 152,178,189 S7P unknown Het
Ahcyl2 T C 6: 29,908,421 Y388H probably damaging Het
Atp1a2 T A 1: 172,284,550 R593* probably null Het
Bicral T C 17: 46,801,668 T869A probably benign Het
Brca2 C T 5: 150,540,478 P1236S probably benign Het
Cacna2d1 C T 5: 16,352,668 Q699* probably null Het
Ccser2 T C 14: 36,940,007 N407D probably damaging Het
Cd300lg A G 11: 102,043,074 Y49C probably damaging Het
Cdh12 C A 15: 21,358,814 T108K probably damaging Het
Ctnnd1 A T 2: 84,610,606 I715K possibly damaging Het
Dbr1 A G 9: 99,575,983 T19A probably damaging Het
Dnah3 C T 7: 120,030,010 A1441T possibly damaging Het
Dpt G A 1: 164,796,939 D70N probably damaging Het
Elk4 C A 1: 132,019,369 P366Q probably damaging Het
Eml4 A C 17: 83,425,311 D131A probably benign Het
Faap24 A G 7: 35,392,871 I207T possibly damaging Het
Fam198b T C 3: 79,886,548 Y108H probably damaging Het
Fam219a T C 4: 41,521,925 S41G probably benign Het
Gm15448 T A 7: 3,821,262 K629* probably null Het
Ifi203 T C 1: 173,928,385 probably benign Het
Inpp4a T C 1: 37,369,423 V295A probably benign Het
Kif2a A G 13: 106,982,594 Y267H probably damaging Het
Kprp T A 3: 92,825,197 Q182L probably benign Het
Krt90 T C 15: 101,557,175 K337R possibly damaging Het
Lrp2 T A 2: 69,483,028 Y2453F possibly damaging Het
Magel2 A C 7: 62,379,787 Y813S unknown Het
Myh7 C A 14: 54,974,644 E1548* probably null Het
Myh8 A G 11: 67,297,539 T1009A probably benign Het
Nab2 T A 10: 127,666,508 probably benign Het
Neb T C 2: 52,296,273 D929G possibly damaging Het
Nelfb A C 2: 25,210,493 V155G probably damaging Het
Nmur1 C A 1: 86,387,848 M65I possibly damaging Het
Nop56 C T 2: 130,277,881 R81* probably null Het
Npnt C T 3: 132,908,396 C47Y probably damaging Het
Nrp1 G T 8: 128,480,954 C610F probably damaging Het
Olfr1175-ps T C 2: 88,323,262 K148E probably damaging Het
Olfr1243 T A 2: 89,527,604 I269F probably damaging Het
Olfr766-ps1 T A 10: 129,064,675 M1L probably benign Het
Pax5 G A 4: 44,679,501 Q93* probably null Het
Pcnt G T 10: 76,403,835 Q1273K probably damaging Het
Pde4dip G A 3: 97,724,183 Q1137* probably null Het
Pfas A T 11: 68,990,760 D959E probably benign Het
Prex1 TCCGACCCC TCCGACCCCGACCCC 2: 166,613,187 probably benign Het
Prpf40b C T 15: 99,306,400 Q182* probably null Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Rpe65 A C 3: 159,622,685 E406A probably damaging Het
Serpina3k A T 12: 104,341,142 Y211F probably benign Het
Shkbp1 T C 7: 27,355,281 I65V possibly damaging Het
Slc22a29 G A 19: 8,160,580 P544S probably benign Het
Stab2 T C 10: 86,850,837 D2281G probably damaging Het
Tjp2 A G 19: 24,132,688 M64T probably benign Het
Tnfrsf8 C T 4: 145,274,403 V378I possibly damaging Het
Trpm1 A T 7: 64,226,714 probably null Het
Ubqln3 A G 7: 104,141,275 I536T probably benign Het
Vmn1r44 A G 6: 89,893,754 T161A possibly damaging Het
Vmn2r108 T A 17: 20,471,083 I393F possibly damaging Het
Other mutations in Cyp17a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01524:Cyp17a1 APN 19 46671056 missense probably benign 0.00
IGL01839:Cyp17a1 APN 19 46670671 missense possibly damaging 0.89
IGL01901:Cyp17a1 APN 19 46671092 missense possibly damaging 0.64
IGL02033:Cyp17a1 APN 19 46672607 nonsense probably null
IGL02349:Cyp17a1 APN 19 46667497 missense probably damaging 1.00
IGL02663:Cyp17a1 APN 19 46672566 missense probably damaging 1.00
IGL02883:Cyp17a1 APN 19 46669351 missense probably benign 0.00
IGL03092:Cyp17a1 APN 19 46672611 missense possibly damaging 0.79
IGL03239:Cyp17a1 APN 19 46667357 missense probably damaging 1.00
IGL03336:Cyp17a1 APN 19 46671035 missense probably benign 0.00
R3773:Cyp17a1 UTSW 19 46669723 missense probably damaging 0.97
R4445:Cyp17a1 UTSW 19 46668023 missense probably damaging 1.00
R4446:Cyp17a1 UTSW 19 46668023 missense probably damaging 1.00
R4572:Cyp17a1 UTSW 19 46670551 missense probably damaging 1.00
R5544:Cyp17a1 UTSW 19 46672654 missense probably damaging 1.00
R5730:Cyp17a1 UTSW 19 46672656 missense possibly damaging 0.49
R6163:Cyp17a1 UTSW 19 46669322 missense possibly damaging 0.69
R6271:Cyp17a1 UTSW 19 46672720 missense probably benign 0.17
R6728:Cyp17a1 UTSW 19 46669234 missense probably benign
R6729:Cyp17a1 UTSW 19 46670581 missense probably benign
R7395:Cyp17a1 UTSW 19 46670695 missense probably benign
R8056:Cyp17a1 UTSW 19 46670591 missense possibly damaging 0.95
R8308:Cyp17a1 UTSW 19 46668077 missense probably benign 0.09
X0020:Cyp17a1 UTSW 19 46671020 missense possibly damaging 0.88
Z1177:Cyp17a1 UTSW 19 46672659 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGGGATCAGTCAACGCTGTC -3'
(R):5'- GGGATCTCACAGCACTCATCAG -3'

Sequencing Primer
(F):5'- AGTCAACGCTGTCGCCTCTG -3'
(R):5'- GCACTCATCAGGACTGCAGATAG -3'
Posted On2019-05-13