Mutagenetix > Incidental Mutations

Incidental Mutation 'R7025:Cyp17a1'

545936

Institutional Source

Beutler Lab

Gene Symbol

Cyp17a1

Ensembl Gene

ENSMUSG00000003555

Gene Name

cytochrome P450, family 17, subfamily a, polypeptide 1

Synonyms

steroid 17-alpha hydroxylase, p450c17, Cyp17

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.249) question?

Stock #

R7025 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

46667165-46672974 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 46670980 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 137 (D137V)

Ref Sequence

ENSEMBL: ENSMUSP00000026012 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026012]

Predicted Effect

probably damaging
Transcript: ENSMUST00000026012
AA Change: D137V

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000026012
Gene: ENSMUSG00000003555
AA Change: D137V

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:p450	28	492	2.6e-140	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. It has both 17alpha-hydroxylase and 17,20-lyase activities and is a key enzyme in the steroidogenic pathway that produces progestins, mineralocorticoids, glucocorticoids, androgens, and estrogens. Mutations in this gene are associated with isolated steroid-17 alpha-hydroxylase deficiency, 17-alpha-hydroxylase/17,20-lyase deficiency, pseudohermaphroditism, and adrenal hyperplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos display early embryonic lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acbd4	T	A	11: 103,104,538	L90M	probably damaging	Het
Acot7	T	C	4: 152,178,189	S7P	unknown	Het
Ahcyl2	T	C	6: 29,908,421	Y388H	probably damaging	Het
Atp1a2	T	A	1: 172,284,550	R593*	probably null	Het
Bicral	T	C	17: 46,801,668	T869A	probably benign	Het
Brca2	C	T	5: 150,540,478	P1236S	probably benign	Het
Cacna2d1	C	T	5: 16,352,668	Q699*	probably null	Het
Ccser2	T	C	14: 36,940,007	N407D	probably damaging	Het
Cd300lg	A	G	11: 102,043,074	Y49C	probably damaging	Het
Cdh12	C	A	15: 21,358,814	T108K	probably damaging	Het
Ctnnd1	A	T	2: 84,610,606	I715K	possibly damaging	Het
Dbr1	A	G	9: 99,575,983	T19A	probably damaging	Het
Dnah3	C	T	7: 120,030,010	A1441T	possibly damaging	Het
Dpt	G	A	1: 164,796,939	D70N	probably damaging	Het
Elk4	C	A	1: 132,019,369	P366Q	probably damaging	Het
Eml4	A	C	17: 83,425,311	D131A	probably benign	Het
Faap24	A	G	7: 35,392,871	I207T	possibly damaging	Het
Fam198b	T	C	3: 79,886,548	Y108H	probably damaging	Het
Fam219a	T	C	4: 41,521,925	S41G	probably benign	Het
Gm15448	T	A	7: 3,821,262	K629*	probably null	Het
Ifi203	T	C	1: 173,928,385		probably benign	Het
Inpp4a	T	C	1: 37,369,423	V295A	probably benign	Het
Kif2a	A	G	13: 106,982,594	Y267H	probably damaging	Het
Kprp	T	A	3: 92,825,197	Q182L	probably benign	Het
Krt90	T	C	15: 101,557,175	K337R	possibly damaging	Het
Lrp2	T	A	2: 69,483,028	Y2453F	possibly damaging	Het
Magel2	A	C	7: 62,379,787	Y813S	unknown	Het
Myh7	C	A	14: 54,974,644	E1548*	probably null	Het
Myh8	A	G	11: 67,297,539	T1009A	probably benign	Het
Nab2	T	A	10: 127,666,508		probably benign	Het
Neb	T	C	2: 52,296,273	D929G	possibly damaging	Het
Nelfb	A	C	2: 25,210,493	V155G	probably damaging	Het
Nmur1	C	A	1: 86,387,848	M65I	possibly damaging	Het
Nop56	C	T	2: 130,277,881	R81*	probably null	Het
Npnt	C	T	3: 132,908,396	C47Y	probably damaging	Het
Nrp1	G	T	8: 128,480,954	C610F	probably damaging	Het
Olfr1175-ps	T	C	2: 88,323,262	K148E	probably damaging	Het
Olfr1243	T	A	2: 89,527,604	I269F	probably damaging	Het
Olfr766-ps1	T	A	10: 129,064,675	M1L	probably benign	Het
Pax5	G	A	4: 44,679,501	Q93*	probably null	Het
Pcnt	G	T	10: 76,403,835	Q1273K	probably damaging	Het
Pde4dip	G	A	3: 97,724,183	Q1137*	probably null	Het
Pfas	A	T	11: 68,990,760	D959E	probably benign	Het
Prex1	TCCGACCCC	TCCGACCCCGACCCC	2: 166,613,187		probably benign	Het
Prpf40b	C	T	15: 99,306,400	Q182*	probably null	Het
Ptk2	G	A	15: 73,221,809	P854S	possibly damaging	Het
Rpe65	A	C	3: 159,622,685	E406A	probably damaging	Het
Serpina3k	A	T	12: 104,341,142	Y211F	probably benign	Het
Shkbp1	T	C	7: 27,355,281	I65V	possibly damaging	Het
Slc22a29	G	A	19: 8,160,580	P544S	probably benign	Het
Stab2	T	C	10: 86,850,837	D2281G	probably damaging	Het
Tjp2	A	G	19: 24,132,688	M64T	probably benign	Het
Tnfrsf8	C	T	4: 145,274,403	V378I	possibly damaging	Het
Trpm1	A	T	7: 64,226,714		probably null	Het
Ubqln3	A	G	7: 104,141,275	I536T	probably benign	Het
Vmn1r44	A	G	6: 89,893,754	T161A	possibly damaging	Het
Vmn2r108	T	A	17: 20,471,083	I393F	possibly damaging	Het

Other mutations in Cyp17a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01524:Cyp17a1	APN	19	46671056	missense	probably benign	0.00
IGL01839:Cyp17a1	APN	19	46670671	missense	possibly damaging	0.89
IGL01901:Cyp17a1	APN	19	46671092	missense	possibly damaging	0.64
IGL02033:Cyp17a1	APN	19	46672607	nonsense	probably null
IGL02349:Cyp17a1	APN	19	46667497	missense	probably damaging	1.00
IGL02663:Cyp17a1	APN	19	46672566	missense	probably damaging	1.00
IGL02883:Cyp17a1	APN	19	46669351	missense	probably benign	0.00
IGL03092:Cyp17a1	APN	19	46672611	missense	possibly damaging	0.79
IGL03239:Cyp17a1	APN	19	46667357	missense	probably damaging	1.00
IGL03336:Cyp17a1	APN	19	46671035	missense	probably benign	0.00
R3773:Cyp17a1	UTSW	19	46669723	missense	probably damaging	0.97
R4445:Cyp17a1	UTSW	19	46668023	missense	probably damaging	1.00
R4446:Cyp17a1	UTSW	19	46668023	missense	probably damaging	1.00
R4572:Cyp17a1	UTSW	19	46670551	missense	probably damaging	1.00
R5544:Cyp17a1	UTSW	19	46672654	missense	probably damaging	1.00
R5730:Cyp17a1	UTSW	19	46672656	missense	possibly damaging	0.49
R6163:Cyp17a1	UTSW	19	46669322	missense	possibly damaging	0.69
R6271:Cyp17a1	UTSW	19	46672720	missense	probably benign	0.17
R6728:Cyp17a1	UTSW	19	46669234	missense	probably benign
R6729:Cyp17a1	UTSW	19	46670581	missense	probably benign
R7395:Cyp17a1	UTSW	19	46670695	missense	probably benign
R8056:Cyp17a1	UTSW	19	46670591	missense	possibly damaging	0.95
R8308:Cyp17a1	UTSW	19	46668077	missense	probably benign	0.09
X0020:Cyp17a1	UTSW	19	46671020	missense	possibly damaging	0.88
Z1177:Cyp17a1	UTSW	19	46672659	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- AGGGATCAGTCAACGCTGTC -3'
(R):5'- GGGATCTCACAGCACTCATCAG -3'

Sequencing Primer
(F):5'- AGTCAACGCTGTCGCCTCTG -3'
(R):5'- GCACTCATCAGGACTGCAGATAG -3'

Posted On

2019-05-13