Incidental Mutation 'R7026:Dnah7a'
ID 545938
Institutional Source Beutler Lab
Gene Symbol Dnah7a
Ensembl Gene ENSMUSG00000096141
Gene Name dynein, axonemal, heavy chain 7A
Synonyms Dnahc7, LOC381341, Dnahc7a
MMRRC Submission 045127-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.147) question?
Stock # R7026 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 53436165-53745943 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 53543448 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 2241 (M2241L)
Ref Sequence ENSEMBL: ENSMUSP00000092571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094964]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000094964
AA Change: M2241L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000092571
Gene: ENSMUSG00000096141
AA Change: M2241L

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
coiled coil region 504 537 N/A INTRINSIC
Pfam:DHC_N2 756 1165 3.1e-149 PFAM
AAA 1320 1459 2.46e-1 SMART
Blast:AAA 1601 1879 1e-87 BLAST
AAA 1968 2116 5.39e-2 SMART
Pfam:AAA_8 2303 2574 6.9e-75 PFAM
Pfam:MT 2586 2936 2.1e-55 PFAM
Pfam:AAA_9 2957 3182 1.3e-98 PFAM
Pfam:Dynein_heavy 3318 4020 2.3e-287 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A T 19: 43,805,392 (GRCm39) M749L probably benign Het
Abcc2 A G 19: 43,818,974 (GRCm39) N1321S probably benign Het
Acsm2 T A 7: 119,191,450 (GRCm39) V506E probably damaging Het
Add2 G A 6: 86,063,965 (GRCm39) R88Q probably benign Het
Adgra3 A G 5: 50,118,083 (GRCm39) V1155A probably benign Het
Ahsg T A 16: 22,710,963 (GRCm39) D33E probably damaging Het
Alox12b A T 11: 69,048,131 (GRCm39) D20V possibly damaging Het
Alppl2 A G 1: 87,017,420 (GRCm39) probably null Het
Ankfn1 A G 11: 89,530,403 (GRCm39) *49Q probably null Het
Bcl11b T C 12: 107,882,851 (GRCm39) D488G probably damaging Het
Bcl2l10 T A 9: 75,258,364 (GRCm39) F175L probably benign Het
C2cd3 T A 7: 100,081,299 (GRCm39) D127E probably damaging Het
Cacna1c C T 6: 118,614,732 (GRCm39) V1311I probably damaging Het
Cd55b A T 1: 130,316,427 (GRCm39) I374K probably benign Het
Cfap36 T C 11: 29,172,565 (GRCm39) T267A probably benign Het
Cibar2 G A 8: 120,895,324 (GRCm39) H193Y probably damaging Het
Cog1 T C 11: 113,540,415 (GRCm39) L10P probably damaging Het
Dock10 G T 1: 80,479,504 (GRCm39) A1809E probably benign Het
Dock7 A T 4: 98,967,156 (GRCm39) D255E probably benign Het
Exph5 T C 9: 53,251,728 (GRCm39) F123L probably benign Het
Fbxw27 C A 9: 109,617,146 (GRCm39) K118N possibly damaging Het
Fscb C A 12: 64,518,391 (GRCm39) S1025I unknown Het
Get4 C T 5: 139,238,358 (GRCm39) R47W possibly damaging Het
Gm3676 G A 14: 41,366,072 (GRCm39) S81F probably benign Het
Gulp1 C T 1: 44,820,245 (GRCm39) P251S possibly damaging Het
Hhatl T C 9: 121,617,339 (GRCm39) D298G probably benign Het
Hsf2bp T A 17: 32,252,254 (GRCm39) K60N possibly damaging Het
Ints4 T A 7: 97,168,361 (GRCm39) V625D possibly damaging Het
Iqch T A 9: 63,432,421 (GRCm39) K286* probably null Het
Irak1bp1 T A 9: 82,712,084 (GRCm39) S2T possibly damaging Het
Kdm3b G A 18: 34,955,517 (GRCm39) V1135I possibly damaging Het
Lama3 C A 18: 12,649,605 (GRCm39) N181K probably damaging Het
Lrfn2 T G 17: 49,404,005 (GRCm39) S709R probably benign Het
Lrp12 T C 15: 39,743,566 (GRCm39) H123R probably damaging Het
Lrp1b A G 2: 41,159,234 (GRCm39) S1569P probably damaging Het
Lrp2 T G 2: 69,352,131 (GRCm39) Q635P probably damaging Het
Mboat2 T C 12: 24,998,381 (GRCm39) probably null Het
Mctp1 A G 13: 76,954,378 (GRCm39) T596A probably benign Het
Mroh9 T A 1: 162,888,251 (GRCm39) M275L probably benign Het
Ms4a10 A C 19: 10,944,869 (GRCm39) probably null Het
Myo9a C T 9: 59,722,617 (GRCm39) R560C probably damaging Het
Or11h4b A G 14: 50,918,716 (GRCm39) I125T probably damaging Het
Or5b107 A G 19: 13,142,779 (GRCm39) T134A probably benign Het
Or6z1 T A 7: 6,504,820 (GRCm39) H135L probably damaging Het
Ormdl3 A G 11: 98,474,808 (GRCm39) V45A possibly damaging Het
Parp4 T C 14: 56,858,049 (GRCm39) Y894H probably benign Het
Pigo G A 4: 43,023,380 (GRCm39) Q259* probably null Het
Prrc2a G A 17: 35,380,803 (GRCm39) P70S unknown Het
Rab3ip A G 10: 116,773,441 (GRCm39) I124T probably benign Het
Rap1b A G 10: 117,654,384 (GRCm39) I21T probably benign Het
Rasgrf2 T A 13: 92,131,732 (GRCm39) S642C probably damaging Het
Rb1 T C 14: 73,535,539 (GRCm39) E106G probably benign Het
Reps1 C A 10: 17,983,437 (GRCm39) R427S probably damaging Het
Rnf213 A C 11: 119,370,481 (GRCm39) H4760P possibly damaging Het
Rtl1 A G 12: 109,559,595 (GRCm39) I748T probably damaging Het
Sco1 A T 11: 66,944,683 (GRCm39) K102M probably damaging Het
Sec16b T C 1: 157,362,281 (GRCm39) M44T possibly damaging Het
Slc7a10 T C 7: 34,898,139 (GRCm39) M297T probably damaging Het
Smchd1 T C 17: 71,656,662 (GRCm39) H1935R probably benign Het
Sowaha G A 11: 53,370,050 (GRCm39) R229W probably damaging Het
Sptlc3 A T 2: 139,379,608 (GRCm39) M83L probably benign Het
Tbc1d9 T C 8: 83,968,192 (GRCm39) V431A probably benign Het
Tmem98 A G 11: 80,712,214 (GRCm39) E217G possibly damaging Het
Trim13 T A 14: 61,842,562 (GRCm39) L193* probably null Het
Trp53bp2 T C 1: 182,270,300 (GRCm39) S367P probably benign Het
Tsc2 T G 17: 24,845,713 (GRCm39) I202L probably damaging Het
Twf2 T A 9: 106,092,079 (GRCm39) V312E probably damaging Het
Usp34 G T 11: 23,311,622 (GRCm39) L471F probably damaging Het
Vps37c A G 19: 10,683,632 (GRCm39) D18G probably damaging Het
Zfp1010 T A 2: 176,957,361 (GRCm39) I46F probably benign Het
Other mutations in Dnah7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Dnah7a APN 1 53,458,843 (GRCm39) missense probably damaging 0.99
IGL00510:Dnah7a APN 1 53,540,701 (GRCm39) missense probably damaging 1.00
IGL00545:Dnah7a APN 1 53,496,905 (GRCm39) missense possibly damaging 0.87
IGL01320:Dnah7a APN 1 53,473,205 (GRCm39) missense probably benign 0.32
IGL01322:Dnah7a APN 1 53,473,205 (GRCm39) missense probably benign 0.32
IGL01357:Dnah7a APN 1 53,701,540 (GRCm39) missense probably benign
IGL01417:Dnah7a APN 1 53,623,759 (GRCm39) missense probably benign 0.01
IGL01508:Dnah7a APN 1 53,666,231 (GRCm39) missense probably benign 0.00
IGL01511:Dnah7a APN 1 53,458,754 (GRCm39) missense probably damaging 1.00
IGL01545:Dnah7a APN 1 53,557,941 (GRCm39) missense probably benign
IGL01575:Dnah7a APN 1 53,466,979 (GRCm39) splice site probably benign
IGL01667:Dnah7a APN 1 53,586,451 (GRCm39) missense probably damaging 1.00
IGL01712:Dnah7a APN 1 53,462,429 (GRCm39) missense probably benign 0.23
IGL01824:Dnah7a APN 1 53,543,429 (GRCm39) missense probably benign
IGL01829:Dnah7a APN 1 53,657,227 (GRCm39) missense possibly damaging 0.64
IGL01861:Dnah7a APN 1 53,623,608 (GRCm39) splice site probably benign
IGL01861:Dnah7a APN 1 53,679,508 (GRCm39) missense probably benign 0.01
IGL01984:Dnah7a APN 1 53,741,174 (GRCm39) splice site probably null
IGL02056:Dnah7a APN 1 53,543,501 (GRCm39) missense probably benign 0.17
IGL02069:Dnah7a APN 1 53,601,053 (GRCm39) splice site probably benign
IGL02072:Dnah7a APN 1 53,644,986 (GRCm39) missense probably damaging 1.00
IGL02110:Dnah7a APN 1 53,450,739 (GRCm39) missense possibly damaging 0.52
IGL02120:Dnah7a APN 1 53,534,876 (GRCm39) missense possibly damaging 0.46
IGL02128:Dnah7a APN 1 53,476,672 (GRCm39) missense probably damaging 1.00
IGL02135:Dnah7a APN 1 53,662,632 (GRCm39) missense probably benign 0.01
IGL02151:Dnah7a APN 1 53,512,023 (GRCm39) missense probably benign 0.08
IGL02156:Dnah7a APN 1 53,458,882 (GRCm39) missense probably benign 0.27
IGL02270:Dnah7a APN 1 53,512,052 (GRCm39) missense possibly damaging 0.93
IGL02282:Dnah7a APN 1 53,682,669 (GRCm39) missense possibly damaging 0.93
IGL02328:Dnah7a APN 1 53,564,096 (GRCm39) critical splice donor site probably null
IGL02370:Dnah7a APN 1 53,674,556 (GRCm39) missense probably benign 0.00
IGL02420:Dnah7a APN 1 53,725,702 (GRCm39) missense probably benign
IGL02458:Dnah7a APN 1 53,657,487 (GRCm39) nonsense probably null
IGL02489:Dnah7a APN 1 53,686,481 (GRCm39) missense possibly damaging 0.94
IGL02554:Dnah7a APN 1 53,657,205 (GRCm39) missense possibly damaging 0.93
IGL02578:Dnah7a APN 1 53,472,074 (GRCm39) missense probably benign 0.00
IGL02646:Dnah7a APN 1 53,564,194 (GRCm39) missense probably damaging 0.99
IGL02675:Dnah7a APN 1 53,543,183 (GRCm39) missense possibly damaging 0.96
IGL02688:Dnah7a APN 1 53,483,631 (GRCm39) missense possibly damaging 0.93
IGL02858:Dnah7a APN 1 53,512,118 (GRCm39) splice site probably benign
IGL02874:Dnah7a APN 1 53,644,973 (GRCm39) missense possibly damaging 0.70
IGL02887:Dnah7a APN 1 53,561,519 (GRCm39) missense possibly damaging 0.46
IGL02894:Dnah7a APN 1 53,616,487 (GRCm39) missense probably benign 0.27
IGL02926:Dnah7a APN 1 53,535,109 (GRCm39) missense possibly damaging 0.64
IGL03113:Dnah7a APN 1 53,472,163 (GRCm39) missense possibly damaging 0.64
IGL03156:Dnah7a APN 1 53,644,983 (GRCm39) missense probably damaging 0.97
IGL03195:Dnah7a APN 1 53,458,766 (GRCm39) missense probably damaging 1.00
IGL03209:Dnah7a APN 1 53,725,773 (GRCm39) splice site probably benign
IGL03214:Dnah7a APN 1 53,561,368 (GRCm39) critical splice donor site probably null
IGL03242:Dnah7a APN 1 53,659,882 (GRCm39) missense probably benign 0.02
IGL03251:Dnah7a APN 1 53,686,433 (GRCm39) missense probably benign
IGL03265:Dnah7a APN 1 53,568,007 (GRCm39) missense probably benign
IGL03277:Dnah7a APN 1 53,669,481 (GRCm39) missense probably benign 0.00
IGL03278:Dnah7a APN 1 53,536,124 (GRCm39) missense probably benign 0.07
IGL03356:Dnah7a APN 1 53,543,093 (GRCm39) missense probably benign 0.01
PIT4378001:Dnah7a UTSW 1 53,570,362 (GRCm39) missense probably damaging 0.99
R0046:Dnah7a UTSW 1 53,496,033 (GRCm39) splice site probably null
R0051:Dnah7a UTSW 1 53,560,245 (GRCm39) splice site probably benign
R0082:Dnah7a UTSW 1 53,557,867 (GRCm39) missense probably damaging 1.00
R0111:Dnah7a UTSW 1 53,507,843 (GRCm39) missense probably benign 0.03
R0122:Dnah7a UTSW 1 53,436,301 (GRCm39) missense probably damaging 1.00
R0245:Dnah7a UTSW 1 53,540,685 (GRCm39) missense probably damaging 1.00
R0278:Dnah7a UTSW 1 53,543,305 (GRCm39) missense probably benign 0.00
R0309:Dnah7a UTSW 1 53,444,849 (GRCm39) missense probably damaging 0.97
R0334:Dnah7a UTSW 1 53,472,213 (GRCm39) missense possibly damaging 0.61
R0392:Dnah7a UTSW 1 53,543,357 (GRCm39) missense probably damaging 0.97
R0452:Dnah7a UTSW 1 53,644,978 (GRCm39) missense probably benign 0.00
R0511:Dnah7a UTSW 1 53,536,285 (GRCm39) missense probably benign
R0576:Dnah7a UTSW 1 53,675,246 (GRCm39) missense probably benign 0.12
R0592:Dnah7a UTSW 1 53,495,771 (GRCm39) missense possibly damaging 0.91
R0628:Dnah7a UTSW 1 53,536,264 (GRCm39) missense probably benign 0.18
R0689:Dnah7a UTSW 1 53,659,840 (GRCm39) nonsense probably null
R0735:Dnah7a UTSW 1 53,583,670 (GRCm39) missense possibly damaging 0.70
R0800:Dnah7a UTSW 1 53,604,855 (GRCm39) missense probably damaging 1.00
R0829:Dnah7a UTSW 1 53,543,238 (GRCm39) missense probably benign 0.07
R0842:Dnah7a UTSW 1 53,540,833 (GRCm39) missense possibly damaging 0.88
R0879:Dnah7a UTSW 1 53,467,019 (GRCm39) missense possibly damaging 0.85
R1331:Dnah7a UTSW 1 53,507,828 (GRCm39) missense probably damaging 0.99
R1418:Dnah7a UTSW 1 53,686,395 (GRCm39) splice site probably benign
R1421:Dnah7a UTSW 1 53,580,032 (GRCm39) splice site probably benign
R1445:Dnah7a UTSW 1 53,567,956 (GRCm39) missense probably benign 0.02
R1473:Dnah7a UTSW 1 53,535,173 (GRCm39) missense probably benign 0.00
R1538:Dnah7a UTSW 1 53,535,148 (GRCm39) missense possibly damaging 0.71
R1742:Dnah7a UTSW 1 53,495,843 (GRCm39) missense probably benign 0.39
R1754:Dnah7a UTSW 1 53,601,059 (GRCm39) critical splice donor site probably null
R1754:Dnah7a UTSW 1 53,543,344 (GRCm39) missense probably benign 0.18
R1773:Dnah7a UTSW 1 53,472,046 (GRCm39) splice site probably null
R1779:Dnah7a UTSW 1 53,616,382 (GRCm39) missense probably benign
R1816:Dnah7a UTSW 1 53,670,901 (GRCm39) splice site probably benign
R1817:Dnah7a UTSW 1 53,598,307 (GRCm39) missense probably benign
R1818:Dnah7a UTSW 1 53,598,307 (GRCm39) missense probably benign
R1819:Dnah7a UTSW 1 53,598,307 (GRCm39) missense probably benign
R1873:Dnah7a UTSW 1 53,495,691 (GRCm39) splice site probably benign
R1875:Dnah7a UTSW 1 53,495,691 (GRCm39) splice site probably benign
R1884:Dnah7a UTSW 1 53,580,159 (GRCm39) missense probably damaging 0.99
R1902:Dnah7a UTSW 1 53,574,637 (GRCm39) missense probably damaging 1.00
R1903:Dnah7a UTSW 1 53,574,637 (GRCm39) missense probably damaging 1.00
R1908:Dnah7a UTSW 1 53,670,721 (GRCm39) missense probably benign
R1959:Dnah7a UTSW 1 53,724,142 (GRCm39) missense probably benign 0.00
R1960:Dnah7a UTSW 1 53,724,142 (GRCm39) missense probably benign 0.00
R1985:Dnah7a UTSW 1 53,543,093 (GRCm39) missense probably benign 0.01
R1992:Dnah7a UTSW 1 53,621,835 (GRCm39) missense possibly damaging 0.91
R2037:Dnah7a UTSW 1 53,621,741 (GRCm39) missense probably benign 0.00
R2074:Dnah7a UTSW 1 53,496,855 (GRCm39) missense probably benign 0.45
R2076:Dnah7a UTSW 1 53,542,968 (GRCm39) missense probably benign 0.01
R2124:Dnah7a UTSW 1 53,536,101 (GRCm39) missense possibly damaging 0.58
R2191:Dnah7a UTSW 1 53,645,034 (GRCm39) missense possibly damaging 0.54
R2211:Dnah7a UTSW 1 53,518,932 (GRCm39) missense probably benign 0.21
R2220:Dnah7a UTSW 1 53,560,333 (GRCm39) missense probably benign
R2355:Dnah7a UTSW 1 53,621,661 (GRCm39) missense probably benign 0.00
R2495:Dnah7a UTSW 1 53,645,040 (GRCm39) missense probably damaging 1.00
R2901:Dnah7a UTSW 1 53,467,031 (GRCm39) missense probably damaging 0.99
R2911:Dnah7a UTSW 1 53,466,983 (GRCm39) critical splice donor site probably null
R2993:Dnah7a UTSW 1 53,542,713 (GRCm39) missense probably damaging 1.00
R3522:Dnah7a UTSW 1 53,657,275 (GRCm39) missense probably damaging 1.00
R3683:Dnah7a UTSW 1 53,483,675 (GRCm39) missense probably benign
R3723:Dnah7a UTSW 1 53,486,505 (GRCm39) missense probably benign 0.04
R3847:Dnah7a UTSW 1 53,540,815 (GRCm39) missense probably benign 0.01
R4002:Dnah7a UTSW 1 53,670,840 (GRCm39) missense probably benign
R4009:Dnah7a UTSW 1 53,564,164 (GRCm39) missense probably damaging 1.00
R4063:Dnah7a UTSW 1 53,464,376 (GRCm39) missense probably benign
R4193:Dnah7a UTSW 1 53,486,493 (GRCm39) missense probably benign 0.00
R4236:Dnah7a UTSW 1 53,486,524 (GRCm39) missense probably benign 0.00
R4399:Dnah7a UTSW 1 53,557,886 (GRCm39) missense probably damaging 1.00
R4469:Dnah7a UTSW 1 53,483,685 (GRCm39) missense probably benign 0.01
R4494:Dnah7a UTSW 1 53,488,197 (GRCm39) missense probably benign 0.01
R4569:Dnah7a UTSW 1 53,450,818 (GRCm39) missense probably benign 0.01
R4609:Dnah7a UTSW 1 53,495,816 (GRCm39) missense possibly damaging 0.80
R4632:Dnah7a UTSW 1 53,467,110 (GRCm39) missense probably damaging 0.97
R4703:Dnah7a UTSW 1 53,486,476 (GRCm39) critical splice donor site probably null
R4781:Dnah7a UTSW 1 53,464,367 (GRCm39) missense probably benign 0.28
R4854:Dnah7a UTSW 1 53,745,888 (GRCm39) utr 5 prime probably benign
R4932:Dnah7a UTSW 1 53,542,737 (GRCm39) missense possibly damaging 0.90
R4976:Dnah7a UTSW 1 53,737,851 (GRCm39) missense probably benign
R5000:Dnah7a UTSW 1 53,606,201 (GRCm39) missense probably damaging 1.00
R5023:Dnah7a UTSW 1 53,686,407 (GRCm39) nonsense probably null
R5026:Dnah7a UTSW 1 53,701,657 (GRCm39) missense probably damaging 0.99
R5050:Dnah7a UTSW 1 53,536,255 (GRCm39) missense probably benign 0.01
R5119:Dnah7a UTSW 1 53,737,851 (GRCm39) missense probably benign
R5151:Dnah7a UTSW 1 53,659,929 (GRCm39) missense probably benign 0.00
R5155:Dnah7a UTSW 1 53,682,654 (GRCm39) missense probably benign 0.01
R5180:Dnah7a UTSW 1 53,462,446 (GRCm39) missense probably damaging 0.97
R5228:Dnah7a UTSW 1 53,476,768 (GRCm39) critical splice acceptor site probably null
R5237:Dnah7a UTSW 1 53,486,690 (GRCm39) splice site probably null
R5267:Dnah7a UTSW 1 53,518,851 (GRCm39) missense probably damaging 1.00
R5334:Dnah7a UTSW 1 53,542,805 (GRCm39) missense probably benign 0.00
R5358:Dnah7a UTSW 1 53,586,331 (GRCm39) missense probably damaging 1.00
R5401:Dnah7a UTSW 1 53,670,812 (GRCm39) missense probably benign 0.01
R5412:Dnah7a UTSW 1 53,674,503 (GRCm39) missense probably benign
R5496:Dnah7a UTSW 1 53,496,927 (GRCm39) missense probably benign
R5531:Dnah7a UTSW 1 53,458,907 (GRCm39) missense possibly damaging 0.50
R5536:Dnah7a UTSW 1 53,464,412 (GRCm39) missense probably benign
R5543:Dnah7a UTSW 1 53,543,228 (GRCm39) missense probably damaging 1.00
R5597:Dnah7a UTSW 1 53,573,611 (GRCm39) missense probably benign 0.00
R5609:Dnah7a UTSW 1 53,621,753 (GRCm39) missense probably benign 0.03
R5643:Dnah7a UTSW 1 53,444,866 (GRCm39) missense probably benign
R5644:Dnah7a UTSW 1 53,580,138 (GRCm39) missense probably benign 0.33
R5689:Dnah7a UTSW 1 53,444,857 (GRCm39) missense possibly damaging 0.87
R5715:Dnah7a UTSW 1 53,452,937 (GRCm39) missense probably damaging 1.00
R5780:Dnah7a UTSW 1 53,522,478 (GRCm39) missense probably benign 0.03
R5893:Dnah7a UTSW 1 53,496,944 (GRCm39) missense possibly damaging 0.66
R5946:Dnah7a UTSW 1 53,598,467 (GRCm39) missense probably damaging 1.00
R5995:Dnah7a UTSW 1 53,659,829 (GRCm39) missense probably benign 0.00
R6102:Dnah7a UTSW 1 53,598,299 (GRCm39) missense probably benign 0.00
R6108:Dnah7a UTSW 1 53,496,004 (GRCm39) missense probably damaging 1.00
R6133:Dnah7a UTSW 1 53,458,814 (GRCm39) missense probably benign 0.05
R6168:Dnah7a UTSW 1 53,450,727 (GRCm39) missense probably damaging 1.00
R6175:Dnah7a UTSW 1 53,472,181 (GRCm39) missense probably damaging 1.00
R6211:Dnah7a UTSW 1 53,458,795 (GRCm39) missense probably damaging 0.99
R6282:Dnah7a UTSW 1 53,542,760 (GRCm39) missense probably damaging 1.00
R6329:Dnah7a UTSW 1 53,580,273 (GRCm39) missense probably damaging 1.00
R6344:Dnah7a UTSW 1 53,436,349 (GRCm39) missense probably benign 0.02
R6530:Dnah7a UTSW 1 53,542,856 (GRCm39) missense probably benign 0.04
R6574:Dnah7a UTSW 1 53,495,693 (GRCm39) critical splice donor site probably null
R6608:Dnah7a UTSW 1 53,564,277 (GRCm39) missense probably benign
R6625:Dnah7a UTSW 1 53,604,916 (GRCm39) missense probably benign 0.05
R6661:Dnah7a UTSW 1 53,662,609 (GRCm39) missense probably benign 0.00
R6681:Dnah7a UTSW 1 53,560,385 (GRCm39) critical splice acceptor site probably null
R6747:Dnah7a UTSW 1 53,675,221 (GRCm39) missense probably benign 0.01
R6774:Dnah7a UTSW 1 53,737,810 (GRCm39) missense probably benign
R6823:Dnah7a UTSW 1 53,495,863 (GRCm39) missense probably benign
R6900:Dnah7a UTSW 1 53,701,510 (GRCm39) missense probably damaging 0.97
R6940:Dnah7a UTSW 1 53,670,836 (GRCm39) missense probably benign 0.09
R6956:Dnah7a UTSW 1 53,616,446 (GRCm39) missense probably benign 0.02
R6978:Dnah7a UTSW 1 53,701,526 (GRCm39) missense probably null
R6988:Dnah7a UTSW 1 53,621,784 (GRCm39) missense possibly damaging 0.62
R7027:Dnah7a UTSW 1 53,670,665 (GRCm39) missense probably benign 0.01
R7033:Dnah7a UTSW 1 53,518,820 (GRCm39) missense probably damaging 1.00
R7072:Dnah7a UTSW 1 53,458,912 (GRCm39) missense probably benign 0.00
R7096:Dnah7a UTSW 1 53,522,599 (GRCm39) missense possibly damaging 0.90
R7142:Dnah7a UTSW 1 53,452,927 (GRCm39) nonsense probably null
R7144:Dnah7a UTSW 1 53,737,867 (GRCm39) splice site probably null
R7167:Dnah7a UTSW 1 53,542,935 (GRCm39) missense probably benign 0.00
R7182:Dnah7a UTSW 1 53,659,620 (GRCm39) splice site probably null
R7196:Dnah7a UTSW 1 53,724,000 (GRCm39) missense probably benign 0.00
R7206:Dnah7a UTSW 1 53,737,792 (GRCm39) nonsense probably null
R7215:Dnah7a UTSW 1 53,657,509 (GRCm39) missense probably damaging 0.99
R7224:Dnah7a UTSW 1 53,436,420 (GRCm39) missense probably benign 0.00
R7264:Dnah7a UTSW 1 53,557,973 (GRCm39) missense probably benign
R7282:Dnah7a UTSW 1 53,724,059 (GRCm39) critical splice acceptor site probably null
R7365:Dnah7a UTSW 1 53,536,297 (GRCm39) missense probably benign
R7392:Dnah7a UTSW 1 53,540,820 (GRCm39) missense probably benign 0.00
R7454:Dnah7a UTSW 1 53,557,923 (GRCm39) missense probably benign
R7471:Dnah7a UTSW 1 53,458,858 (GRCm39) missense probably damaging 1.00
R7547:Dnah7a UTSW 1 53,702,996 (GRCm39) missense probably benign 0.00
R7554:Dnah7a UTSW 1 53,567,857 (GRCm39) missense possibly damaging 0.87
R7655:Dnah7a UTSW 1 53,535,164 (GRCm39) missense possibly damaging 0.50
R7656:Dnah7a UTSW 1 53,535,164 (GRCm39) missense possibly damaging 0.50
R7666:Dnah7a UTSW 1 53,586,456 (GRCm39) missense probably benign 0.00
R7721:Dnah7a UTSW 1 53,670,842 (GRCm39) missense probably benign
R7813:Dnah7a UTSW 1 53,657,245 (GRCm39) missense probably benign
R7839:Dnah7a UTSW 1 53,606,334 (GRCm39) missense probably benign 0.08
R7959:Dnah7a UTSW 1 53,682,621 (GRCm39) missense probably benign 0.00
R7984:Dnah7a UTSW 1 53,543,377 (GRCm39) missense probably benign 0.01
R7985:Dnah7a UTSW 1 53,557,886 (GRCm39) missense probably damaging 1.00
R8116:Dnah7a UTSW 1 53,543,049 (GRCm39) missense probably benign
R8140:Dnah7a UTSW 1 53,540,748 (GRCm39) missense probably benign 0.02
R8184:Dnah7a UTSW 1 53,666,194 (GRCm39) missense probably benign 0.03
R8339:Dnah7a UTSW 1 53,724,178 (GRCm39) missense probably benign
R8352:Dnah7a UTSW 1 53,466,986 (GRCm39) missense probably null 0.01
R8423:Dnah7a UTSW 1 53,512,063 (GRCm39) missense possibly damaging 0.84
R8428:Dnah7a UTSW 1 53,512,112 (GRCm39) missense probably damaging 0.98
R8432:Dnah7a UTSW 1 53,657,195 (GRCm39) missense possibly damaging 0.46
R8452:Dnah7a UTSW 1 53,466,986 (GRCm39) missense probably null 0.01
R8458:Dnah7a UTSW 1 53,657,142 (GRCm39) missense probably benign 0.01
R8493:Dnah7a UTSW 1 53,512,067 (GRCm39) missense probably damaging 1.00
R8498:Dnah7a UTSW 1 53,657,139 (GRCm39) missense probably benign 0.01
R8502:Dnah7a UTSW 1 53,679,520 (GRCm39) missense probably benign 0.39
R8692:Dnah7a UTSW 1 53,472,175 (GRCm39) missense probably benign 0.00
R8700:Dnah7a UTSW 1 53,535,088 (GRCm39) missense possibly damaging 0.62
R8709:Dnah7a UTSW 1 53,674,476 (GRCm39) missense probably benign
R8856:Dnah7a UTSW 1 53,462,422 (GRCm39) missense probably damaging 1.00
R8875:Dnah7a UTSW 1 53,682,682 (GRCm39) missense probably benign 0.10
R8967:Dnah7a UTSW 1 53,682,594 (GRCm39) splice site probably benign
R8982:Dnah7a UTSW 1 53,570,301 (GRCm39) missense probably benign
R8984:Dnah7a UTSW 1 53,674,436 (GRCm39) nonsense probably null
R8993:Dnah7a UTSW 1 53,543,262 (GRCm39) missense probably damaging 1.00
R9008:Dnah7a UTSW 1 53,701,501 (GRCm39) missense possibly damaging 0.81
R9022:Dnah7a UTSW 1 53,512,116 (GRCm39) critical splice acceptor site probably null
R9028:Dnah7a UTSW 1 53,560,297 (GRCm39) missense probably benign 0.00
R9077:Dnah7a UTSW 1 53,741,218 (GRCm39) missense unknown
R9167:Dnah7a UTSW 1 53,657,370 (GRCm39) missense probably benign 0.00
R9206:Dnah7a UTSW 1 53,540,757 (GRCm39) missense probably benign 0.11
R9226:Dnah7a UTSW 1 53,560,326 (GRCm39) missense possibly damaging 0.93
R9251:Dnah7a UTSW 1 53,621,671 (GRCm39) missense probably damaging 1.00
R9265:Dnah7a UTSW 1 53,674,505 (GRCm39) missense probably benign
R9350:Dnah7a UTSW 1 53,436,307 (GRCm39) missense probably benign 0.19
R9369:Dnah7a UTSW 1 53,564,222 (GRCm39) missense possibly damaging 0.72
R9369:Dnah7a UTSW 1 53,543,421 (GRCm39) missense probably benign
R9372:Dnah7a UTSW 1 53,543,474 (GRCm39) missense probably benign
R9376:Dnah7a UTSW 1 53,568,058 (GRCm39) critical splice acceptor site probably null
R9378:Dnah7a UTSW 1 53,621,776 (GRCm39) missense probably benign 0.32
R9401:Dnah7a UTSW 1 53,568,026 (GRCm39) missense probably benign 0.01
R9431:Dnah7a UTSW 1 53,450,812 (GRCm39) missense possibly damaging 0.90
R9529:Dnah7a UTSW 1 53,561,495 (GRCm39) missense probably damaging 1.00
R9701:Dnah7a UTSW 1 53,561,388 (GRCm39) missense probably benign 0.03
R9712:Dnah7a UTSW 1 53,598,299 (GRCm39) missense probably benign 0.00
R9799:Dnah7a UTSW 1 53,557,968 (GRCm39) missense probably benign 0.00
R9802:Dnah7a UTSW 1 53,561,388 (GRCm39) missense probably benign 0.03
X0027:Dnah7a UTSW 1 53,512,089 (GRCm39) missense probably damaging 1.00
Z1088:Dnah7a UTSW 1 53,507,802 (GRCm39) missense probably damaging 1.00
Z1176:Dnah7a UTSW 1 53,522,622 (GRCm39) missense probably damaging 1.00
Z1176:Dnah7a UTSW 1 53,458,858 (GRCm39) missense probably damaging 1.00
Z1177:Dnah7a UTSW 1 53,598,261 (GRCm39) missense probably benign 0.21
Z1177:Dnah7a UTSW 1 53,450,815 (GRCm39) missense probably benign 0.08
Z1177:Dnah7a UTSW 1 53,682,616 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CTTCAACAATCATCCTGAGAGC -3'
(R):5'- TCATGTATTGATCACTGAAGCAAAC -3'

Sequencing Primer
(F):5'- ATCCTGAGAGCATCCACATTTG -3'
(R):5'- TGATCACTGAAGCAAACTATTGTATC -3'
Posted On 2019-05-13