Incidental Mutation 'R7026:Reps1'
ID545970
Institutional Source Beutler Lab
Gene Symbol Reps1
Ensembl Gene ENSMUSG00000019854
Gene NameRalBP1 associated Eps domain containing protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.522) question?
Stock #R7026 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location18055861-18125155 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 18107689 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 427 (R427S)
Ref Sequence ENSEMBL: ENSMUSP00000123238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126390] [ENSMUST00000154718] [ENSMUST00000155284] [ENSMUST00000164556]
PDB Structure
SOLUTION STRUCTURE OF THE REPS1 EH DOMAIN [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000126390
AA Change: R427S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123238
Gene: ENSMUSG00000019854
AA Change: R427S

DomainStartEndE-ValueType
EH 3 99 2.34e-2 SMART
low complexity region 156 175 N/A INTRINSIC
low complexity region 205 216 N/A INTRINSIC
low complexity region 254 265 N/A INTRINSIC
EH 278 373 2.18e-34 SMART
low complexity region 390 406 N/A INTRINSIC
low complexity region 545 561 N/A INTRINSIC
low complexity region 574 599 N/A INTRINSIC
Blast:MYSc 613 671 1e-15 BLAST
coiled coil region 750 790 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150029
SMART Domains Protein: ENSMUSP00000119651
Gene: ENSMUSG00000019854

DomainStartEndE-ValueType
Blast:EH 2 86 5e-51 BLAST
low complexity region 143 162 N/A INTRINSIC
low complexity region 192 203 N/A INTRINSIC
low complexity region 241 252 N/A INTRINSIC
EH 265 360 2.18e-34 SMART
low complexity region 377 393 N/A INTRINSIC
low complexity region 505 521 N/A INTRINSIC
low complexity region 534 559 N/A INTRINSIC
Blast:MYSc 573 631 1e-15 BLAST
coiled coil region 709 749 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154718
SMART Domains Protein: ENSMUSP00000119358
Gene: ENSMUSG00000019854

DomainStartEndE-ValueType
EH 3 99 2.34e-2 SMART
low complexity region 156 175 N/A INTRINSIC
low complexity region 205 216 N/A INTRINSIC
low complexity region 254 265 N/A INTRINSIC
EH 278 373 2.18e-34 SMART
low complexity region 390 406 N/A INTRINSIC
low complexity region 484 509 N/A INTRINSIC
Blast:MYSc 523 581 9e-16 BLAST
coiled coil region 660 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155284
SMART Domains Protein: ENSMUSP00000119629
Gene: ENSMUSG00000019854

DomainStartEndE-ValueType
Blast:EH 3 99 6e-65 BLAST
low complexity region 156 175 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000117431
Gene: ENSMUSG00000019854
AA Change: R134S

DomainStartEndE-ValueType
EH 2 82 9.44e-21 SMART
low complexity region 99 115 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155959
SMART Domains Protein: ENSMUSP00000114387
Gene: ENSMUSG00000019854

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 47 58 N/A INTRINSIC
low complexity region 75 86 N/A INTRINSIC
EH 99 194 2.18e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164556
SMART Domains Protein: ENSMUSP00000130501
Gene: ENSMUSG00000019854

DomainStartEndE-ValueType
EH 3 99 2.34e-2 SMART
low complexity region 156 175 N/A INTRINSIC
low complexity region 205 216 N/A INTRINSIC
low complexity region 254 265 N/A INTRINSIC
EH 278 373 2.18e-34 SMART
low complexity region 390 406 N/A INTRINSIC
low complexity region 518 534 N/A INTRINSIC
low complexity region 547 572 N/A INTRINSIC
Blast:MYSc 586 644 9e-16 BLAST
coiled coil region 723 763 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000216576
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a signaling adaptor protein with two EH domains that interacts with proteins that participate in signaling, endocytosis and cytoskeletal changes. The encoded protein has been found in association with intersectin 1 and Src homology 3-domain growth factor receptor-bound 2-like (endophilin) interacting protein 1 when intersectin 1 was isolated from clathrin-coated pits. The encoded protein has also been shown to interact with amphiphysin, a cytoplasmic protein at the surface of synaptic vesicles. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A T 19: 43,816,953 M749L probably benign Het
Abcc2 A G 19: 43,830,535 N1321S probably benign Het
Acsm2 T A 7: 119,592,227 V506E probably damaging Het
Add2 G A 6: 86,086,983 R88Q probably benign Het
Adgra3 A G 5: 49,960,741 V1155A probably benign Het
Ahsg T A 16: 22,892,213 D33E probably damaging Het
Alox12b A T 11: 69,157,305 D20V possibly damaging Het
Alppl2 A G 1: 87,089,698 probably null Het
Ankfn1 A G 11: 89,639,577 *49Q probably null Het
Bcl11b T C 12: 107,916,592 D488G probably damaging Het
Bcl2l10 T A 9: 75,351,082 F175L probably benign Het
C2cd3 T A 7: 100,432,092 D127E probably damaging Het
Cacna1c C T 6: 118,637,771 V1311I probably damaging Het
Cd55b A T 1: 130,388,690 I374K probably benign Het
Cfap36 T C 11: 29,222,565 T267A probably benign Het
Cog1 T C 11: 113,649,589 L10P probably damaging Het
Dnah7a T A 1: 53,504,289 M2241L probably benign Het
Dock10 G T 1: 80,501,787 A1809E probably benign Het
Dock7 A T 4: 99,078,919 D255E probably benign Het
Exph5 T C 9: 53,340,428 F123L probably benign Het
Fam92b G A 8: 120,168,585 H193Y probably damaging Het
Fbxw27 C A 9: 109,788,078 K118N possibly damaging Het
Fscb C A 12: 64,471,617 S1025I unknown Het
Get4 C T 5: 139,252,603 R47W possibly damaging Het
Gm14409 T A 2: 177,265,568 I46F probably benign Het
Gm3676 G A 14: 41,644,115 S81F probably benign Het
Gulp1 C T 1: 44,781,085 P251S possibly damaging Het
Hhatl T C 9: 121,788,273 D298G probably benign Het
Hsf2bp T A 17: 32,033,280 K60N possibly damaging Het
Ints4 T A 7: 97,519,154 V625D possibly damaging Het
Iqch T A 9: 63,525,139 K286* probably null Het
Irak1bp1 T A 9: 82,830,031 S2T possibly damaging Het
Kdm3b G A 18: 34,822,464 V1135I possibly damaging Het
Lama3 C A 18: 12,516,548 N181K probably damaging Het
Lrfn2 T G 17: 49,096,977 S709R probably benign Het
Lrp12 T C 15: 39,880,170 H123R probably damaging Het
Lrp1b A G 2: 41,269,222 S1569P probably damaging Het
Lrp2 T G 2: 69,521,787 Q635P probably damaging Het
Mboat2 T C 12: 24,948,382 probably null Het
Mctp1 A G 13: 76,806,259 T596A probably benign Het
Mroh9 T A 1: 163,060,682 M275L probably benign Het
Ms4a10 A C 19: 10,967,505 probably null Het
Myo9a C T 9: 59,815,334 R560C probably damaging Het
Olfr1348 T A 7: 6,501,821 H135L probably damaging Het
Olfr1461 A G 19: 13,165,415 T134A probably benign Het
Olfr747 A G 14: 50,681,259 I125T probably damaging Het
Ormdl3 A G 11: 98,583,982 V45A possibly damaging Het
Parp4 T C 14: 56,620,592 Y894H probably benign Het
Pigo G A 4: 43,023,380 Q259* probably null Het
Prrc2a G A 17: 35,161,827 P70S unknown Het
Rab3ip A G 10: 116,937,536 I124T probably benign Het
Rap1b A G 10: 117,818,479 I21T probably benign Het
Rasgrf2 T A 13: 91,983,613 S642C probably damaging Het
Rb1 T C 14: 73,298,099 E106G probably benign Het
Rnf213 A C 11: 119,479,655 H4760P possibly damaging Het
Rtl1 A G 12: 109,593,161 I748T probably damaging Het
Sco1 A T 11: 67,053,857 K102M probably damaging Het
Sec16b T C 1: 157,534,711 M44T possibly damaging Het
Slc7a10 T C 7: 35,198,714 M297T probably damaging Het
Smchd1 T C 17: 71,349,667 H1935R probably benign Het
Sowaha G A 11: 53,479,223 R229W probably damaging Het
Sptlc3 A T 2: 139,537,688 M83L probably benign Het
Tbc1d9 T C 8: 83,241,563 V431A probably benign Het
Tmem98 A G 11: 80,821,388 E217G possibly damaging Het
Trim13 T A 14: 61,605,113 L193* probably null Het
Trp53bp2 T C 1: 182,442,735 S367P probably benign Het
Tsc2 T G 17: 24,626,739 I202L probably damaging Het
Twf2 T A 9: 106,214,880 V312E probably damaging Het
Usp34 G T 11: 23,361,622 L471F probably damaging Het
Vps37c A G 19: 10,706,268 D18G probably damaging Het
Other mutations in Reps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Reps1 APN 10 18124895 missense probably damaging 1.00
IGL01161:Reps1 APN 10 18093895 missense probably damaging 1.00
IGL01606:Reps1 APN 10 18107687 missense probably damaging 1.00
IGL01937:Reps1 APN 10 18093836 missense probably benign 0.04
IGL01945:Reps1 APN 10 18093836 missense probably benign 0.04
IGL02208:Reps1 APN 10 18119022 missense probably damaging 1.00
IGL02335:Reps1 APN 10 18056117 critical splice donor site probably null
IGL02706:Reps1 APN 10 18123015 splice site probably benign
IGL02747:Reps1 APN 10 18123600 missense probably damaging 1.00
R0554:Reps1 UTSW 10 18123119 missense possibly damaging 0.71
R0628:Reps1 UTSW 10 18121093 missense probably damaging 1.00
R1074:Reps1 UTSW 10 18094446 missense probably benign 0.01
R1710:Reps1 UTSW 10 18118950 missense possibly damaging 0.75
R1829:Reps1 UTSW 10 18107714 missense probably damaging 1.00
R2116:Reps1 UTSW 10 18124920 missense probably damaging 1.00
R2146:Reps1 UTSW 10 18093313 missense probably benign
R2161:Reps1 UTSW 10 18096283 missense probably damaging 0.99
R3704:Reps1 UTSW 10 18107680 missense probably damaging 1.00
R4115:Reps1 UTSW 10 18104207 missense possibly damaging 0.93
R4654:Reps1 UTSW 10 18114400 missense probably damaging 1.00
R4856:Reps1 UTSW 10 18123625 missense probably damaging 1.00
R4910:Reps1 UTSW 10 18107688 missense probably damaging 1.00
R5127:Reps1 UTSW 10 18093880 missense probably benign
R5521:Reps1 UTSW 10 18104234 missense probably damaging 1.00
R5707:Reps1 UTSW 10 18056010 missense probably benign 0.06
R5724:Reps1 UTSW 10 18114483 missense possibly damaging 0.75
R6564:Reps1 UTSW 10 18122392 splice site probably null
R6996:Reps1 UTSW 10 18093855 missense probably damaging 1.00
R7423:Reps1 UTSW 10 18093887 missense possibly damaging 0.81
X0062:Reps1 UTSW 10 18104226 missense probably damaging 0.99
Z1176:Reps1 UTSW 10 18123125 missense probably damaging 0.99
Z1177:Reps1 UTSW 10 18093779 missense probably benign 0.05
Z1177:Reps1 UTSW 10 18124924 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATTTGCTTATGAAGGTGTTTGCC -3'
(R):5'- CCAAAGGCCTGCCAACTTTC -3'

Sequencing Primer
(F):5'- CTGTTTATAAGATGGCCCAGCACAG -3'
(R):5'- TTCCCTCTAAGCACTACACTGAATC -3'
Posted On2019-05-13