Mutagenetix > Incidental Mutations

Incidental Mutation 'R0610:Nr4a3'

54598

Institutional Source

Beutler Lab

Gene Symbol

Nr4a3

Ensembl Gene

ENSMUSG00000028341

Gene Name

nuclear receptor subfamily 4, group A, member 3

Synonyms

Nor1, TEC, MINOR, NOR-1

MMRRC Submission

038799-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0610 (G1)

Quality Score

110

Status

Validated

Chromosome

Chromosomal Location

48045153-48086447 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 48051903 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Glutamic Acid at position 248 (A248E)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030025]

Predicted Effect

probably benign
Transcript: ENSMUST00000030025
AA Change: A219E

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000030025
Gene: ENSMUSG00000028341
AA Change: A219E

Domain	Start	End	E-Value	Type
Blast:HOLI	1	43	4e-18	BLAST
low complexity region	99	115	N/A	INTRINSIC
low complexity region	139	151	N/A	INTRINSIC
low complexity region	196	210	N/A	INTRINSIC
low complexity region	218	239	N/A	INTRINSIC
low complexity region	269	288	N/A	INTRINSIC
ZnF_C4	290	361	4.57e-39	SMART
low complexity region	376	396	N/A	INTRINSIC
HOLI	440	595	2.46e-21	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133539

Predicted Effect

probably benign
Transcript: ENSMUST00000153369
AA Change: A248E

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000121455
Gene: ENSMUSG00000028341
AA Change: A248E

Domain	Start	End	E-Value	Type
Blast:HOLI	30	73	8e-19	BLAST
low complexity region	129	145	N/A	INTRINSIC
low complexity region	169	181	N/A	INTRINSIC
low complexity region	226	240	N/A	INTRINSIC
low complexity region	248	269	N/A	INTRINSIC
low complexity region	299	318	N/A	INTRINSIC
ZnF_C4	320	391	4.57e-39	SMART
low complexity region	406	426	N/A	INTRINSIC
HOLI	470	625	2.46e-21	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154186

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.4%
20x: 94.7%

Validation Efficiency

99% (97/98)

MGI Phenotype

FUNCTION: This gene encodes a member of the NR4A subfamily of nuclear hormone receptors that bind to DNA and modulate gene expression. The encoded protein has been implicated in T and B lymphocyte apoptosis, and immune cell proliferation. Mice lacking the encoded protein exhibit partial bidirectional circling behavior and inner ear dysfunction. Disruption of this gene in mice also results in defective hippocampal axonal growth and postnatal neuronal cell death. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit defects in the semicircular canals of the inner ear and bidirectional circling behavior. Mice homozygous for another null allele display embryonic lethality with impaired cell migration during gastrulation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930433I11Rik	A	T	7: 40,993,056	T141S	probably benign	Het
4930578I06Rik	G	A	14: 63,986,265	R21*	probably null	Het
9530003J23Rik	A	G	10: 117,237,730	F66S	probably benign	Het
Abca15	A	G	7: 120,365,786	E757G	possibly damaging	Het
Abca5	T	C	11: 110,301,527	T720A	probably benign	Het
Actr5	T	A	2: 158,632,456		probably null	Het
Adgrl3	T	C	5: 81,693,716		probably benign	Het
Adra1a	A	G	14: 66,637,792	D72G	probably damaging	Het
Ahnak	G	T	19: 9,007,878	L2175F	probably benign	Het
AK157302	A	G	13: 21,495,663	T120A	possibly damaging	Het
Apol7a	G	A	15: 77,389,254	A336V	probably benign	Het
Asic1	C	A	15: 99,698,899	H525Q	probably benign	Het
Atxn7l2	T	C	3: 108,204,774	D335G	possibly damaging	Het
Bpgm	G	T	6: 34,504,349	R227L	possibly damaging	Het
Calm4	T	A	13: 3,838,320	V142E	possibly damaging	Het
Catsperg1	A	T	7: 29,190,619	L721Q	probably damaging	Het
Cdh26	A	G	2: 178,449,898	I83M	probably damaging	Het
Cep295	A	C	9: 15,322,754	S2249A	possibly damaging	Het
Cln3	A	G	7: 126,580,189	F139L	probably damaging	Het
Cmpk2	T	A	12: 26,478,056	L424Q	possibly damaging	Het
Col12a1	A	T	9: 79,707,848	V53E	probably benign	Het
Csmd1	G	A	8: 15,918,208	R3140C	possibly damaging	Het
Dagla	A	G	19: 10,271,558	W11R	probably damaging	Het
Dbx2	C	T	15: 95,624,897	V310M	probably benign	Het
Disp2	T	A	2: 118,792,236	C1150S	probably benign	Het
Dock3	T	C	9: 107,023,788	D326G	probably damaging	Het
Dph1	G	T	11: 75,185,957		probably benign	Het
Dyrk1b	C	A	7: 28,186,634	T594K	probably damaging	Het
Evx2	C	A	2: 74,655,987	A353S	probably benign	Het
Fam71f1	T	A	6: 29,326,577	V231E	probably benign	Het
Gm4737	T	C	16: 46,153,901	E371G	probably damaging	Het
Gm4788	G	A	1: 139,701,846	T799I	probably benign	Het
Greb1	A	C	12: 16,696,442	S1276A	probably benign	Het
Hhipl1	T	A	12: 108,319,402	C490*	probably null	Het
Hmmr	G	T	11: 40,715,902	T231K	probably damaging	Het
Hspa4l	A	C	3: 40,779,400	E526D	probably benign	Het
Ibsp	A	G	5: 104,310,134	E179G	probably benign	Het
Ift140	C	T	17: 25,035,803	A150V	probably benign	Het
Igf2bp2	A	G	16: 22,070,309	S416P	probably benign	Het
Ighe	T	C	12: 113,271,743	K294E	unknown	Het
Ino80	G	A	2: 119,382,960	R1249C	probably damaging	Het
Iqca	C	A	1: 90,142,731	G133V	probably null	Het
Kng2	T	A	16: 23,000,594	N231Y	possibly damaging	Het
Lca5	A	T	9: 83,399,739	C331S	probably benign	Het
Lrrc1	A	G	9: 77,472,206	I101T	possibly damaging	Het
Lrrk2	A	T	15: 91,815,416	I2489L	probably benign	Het
Mapk9	A	C	11: 49,863,573	N51T	probably benign	Het
Marf1	C	T	16: 14,142,534	A549T	probably damaging	Het
Nek2	T	A	1: 191,822,515	V113D	probably damaging	Het
Nrp1	T	C	8: 128,502,618	I859T	probably damaging	Het
Olfm5	A	T	7: 104,154,445	Y195*	probably null	Het
Olfr354	T	A	2: 36,907,659	W238R	probably damaging	Het
Olfr71	T	A	4: 43,706,400	H56L	possibly damaging	Het
Olfr955	A	G	9: 39,469,823	L301P	probably damaging	Het
Oxtr	C	T	6: 112,477,177	R42Q	probably benign	Het
Pcnx2	A	G	8: 125,839,687	W1006R	probably damaging	Het
Pdpk1	T	C	17: 24,098,171		probably null	Het
Ryr2	T	A	13: 11,622,952	H3731L	probably damaging	Het
Sdr16c5	T	G	4: 4,016,116	E103D	possibly damaging	Het
Setdb2	A	C	14: 59,417,470	S324A	possibly damaging	Het
Slc17a3	C	T	13: 23,855,858	S293F	probably damaging	Het
Slc17a8	A	T	10: 89,576,626	I499K	probably damaging	Het
Slc2a9	T	A	5: 38,379,942	I389F	probably damaging	Het
Slc30a1	T	C	1: 191,909,424	V394A	probably damaging	Het
Slc41a2	A	G	10: 83,283,728	I390T	possibly damaging	Het
Slco1a1	A	G	6: 141,918,461		probably null	Het
Slit2	A	G	5: 48,275,674	K1053E	possibly damaging	Het
Smarca2	T	A	19: 26,691,391	L930Q	probably damaging	Het
Snx6	T	C	12: 54,751,789	H387R	probably damaging	Het
Sox5	A	T	6: 143,833,439	M622K	possibly damaging	Het
Ston1	C	A	17: 88,635,281	N38K	possibly damaging	Het
Strbp	C	T	2: 37,584,077	V658I	probably damaging	Het
Strn3	T	C	12: 51,610,448		probably null	Het
Suco	T	G	1: 161,859,503	D96A	probably benign	Het
Suco	A	G	1: 161,864,032		probably benign	Het
Sytl2	A	T	7: 90,380,853		probably benign	Het
Tmem41b	T	A	7: 109,981,083	M25L	probably benign	Het
Tmem41b	T	A	7: 109,981,085	D91V	probably damaging	Het
Tmem50b	C	T	16: 91,583,286	A68T	probably damaging	Het
Tmprss11e	G	A	5: 86,707,347	Q400*	probably null	Het
Tnfsf13b	G	A	8: 10,031,661		probably null	Het
Trappc8	A	G	18: 20,837,188	V916A	probably damaging	Het
Trdn	G	T	10: 33,474,453	V673F	probably damaging	Het
Trim28	G	T	7: 13,025,784		probably benign	Het
Txnrd2	T	C	16: 18,472,882	V427A	probably damaging	Het
Uggt1	T	C	1: 36,165,506		probably benign	Het
Vmn1r36	A	G	6: 66,716,420	L51P	probably damaging	Het
Vmn1r63	T	A	7: 5,803,064	M190L	possibly damaging	Het
Vmn2r116	T	A	17: 23,387,312	N399K	probably damaging	Het
Vmn2r117	T	C	17: 23,475,514	N453S	probably benign	Het
Wbp1l	T	A	19: 46,654,670	I370N	probably damaging	Het
Zfp445	T	C	9: 122,852,981	K632E	probably benign	Het
Zfp850	C	T	7: 27,989,394	R463H	probably damaging	Het
Zyg11a	A	G	4: 108,204,857	L249P	probably damaging	Het

Other mutations in Nr4a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01362:Nr4a3	APN	4	48051586	missense	possibly damaging	0.48
IGL01407:Nr4a3	APN	4	48083201	missense	probably benign	0.00
IGL01454:Nr4a3	APN	4	48067803	missense	probably damaging	1.00
IGL01472:Nr4a3	APN	4	48071133	missense	probably damaging	1.00
IGL02622:Nr4a3	APN	4	48051649	missense	probably benign	0.06
IGL03401:Nr4a3	APN	4	48070987	splice site	probably null
bulbous	UTSW	4	48083255	missense	probably damaging	0.98
cronus	UTSW	4	48056539	missense	probably damaging	1.00
I1329:Nr4a3	UTSW	4	48051585	missense	probably benign	0.12
R0486:Nr4a3	UTSW	4	48056525	splice site	probably benign
R1170:Nr4a3	UTSW	4	48051564	missense	probably damaging	0.98
R1170:Nr4a3	UTSW	4	48083324	missense	probably benign	0.01
R1440:Nr4a3	UTSW	4	48051777	missense	probably benign
R1977:Nr4a3	UTSW	4	48056539	missense	probably damaging	1.00
R2016:Nr4a3	UTSW	4	48083252	missense	probably damaging	1.00
R2046:Nr4a3	UTSW	4	48067807	missense	possibly damaging	0.82
R2055:Nr4a3	UTSW	4	48067771	missense	possibly damaging	0.86
R3707:Nr4a3	UTSW	4	48056699	missense	probably damaging	0.99
R3708:Nr4a3	UTSW	4	48056699	missense	probably damaging	0.99
R4246:Nr4a3	UTSW	4	48083125	missense	possibly damaging	0.86
R4657:Nr4a3	UTSW	4	48051522	missense	probably damaging	1.00
R4870:Nr4a3	UTSW	4	48051651	missense	possibly damaging	0.73
R5434:Nr4a3	UTSW	4	48067861	missense	probably damaging	1.00
R5539:Nr4a3	UTSW	4	48056525	splice site	probably null
R5663:Nr4a3	UTSW	4	48055931	missense	probably damaging	1.00
R6513:Nr4a3	UTSW	4	48083255	missense	probably damaging	0.98
R6664:Nr4a3	UTSW	4	48056006	missense	probably damaging	1.00
R6921:Nr4a3	UTSW	4	48051486	missense	probably benign	0.04
R6940:Nr4a3	UTSW	4	48051486	missense	probably benign	0.04
R7076:Nr4a3	UTSW	4	48055957	missense	probably damaging	1.00
R7322:Nr4a3	UTSW	4	48083238	missense	probably benign	0.00
R7347:Nr4a3	UTSW	4	48051290	missense	possibly damaging	0.94
R7348:Nr4a3	UTSW	4	48051290	missense	possibly damaging	0.94
R7349:Nr4a3	UTSW	4	48051290	missense	possibly damaging	0.94
R7361:Nr4a3	UTSW	4	48083203	missense	probably benign	0.00
R7365:Nr4a3	UTSW	4	48051290	missense	possibly damaging	0.94
R7366:Nr4a3	UTSW	4	48051290	missense	possibly damaging	0.94
R7418:Nr4a3	UTSW	4	48051476	missense	probably damaging	1.00
R7659:Nr4a3	UTSW	4	48051269	missense	probably damaging	1.00
R7895:Nr4a3	UTSW	4	48051390	missense	probably benign
R7986:Nr4a3	UTSW	4	48055954	missense	probably damaging	1.00
R8022:Nr4a3	UTSW	4	48051510	missense	probably damaging	1.00
R8226:Nr4a3	UTSW	4	48056588	missense	probably damaging	1.00
R8328:Nr4a3	UTSW	4	48051323	missense	probably damaging	1.00
R8349:Nr4a3	UTSW	4	48052170	missense	probably benign	0.40
R8403:Nr4a3	UTSW	4	48051348	missense	probably damaging	1.00
R8449:Nr4a3	UTSW	4	48052170	missense	probably benign	0.40

Predicted Primers

PCR Primer
(F):5'- CATGTACTTCAAGCAGTCTCCGCC -3'
(R):5'- ATGTGCCTTCCCCAGATGATGAGC -3'

Sequencing Primer
(F):5'- TGTGGGACGACGAGCTG -3'
(R):5'- AGCTCCTATTGGGTGGCG -3'

Posted On

2013-07-11