Incidental Mutation 'R0610:Zyg11a'
ID54599
Institutional Source Beutler Lab
Gene Symbol Zyg11a
Ensembl Gene ENSMUSG00000034645
Gene Namezyg-11 family member A, cell cycle regulator
Synonyms
MMRRC Submission 038799-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R0610 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location108181738-108218048 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108204857 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 249 (L249P)
Ref Sequence ENSEMBL: ENSMUSP00000152477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043793] [ENSMUST00000106690] [ENSMUST00000223127]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043793
AA Change: L247P

PolyPhen 2 Score 0.541 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000038478
Gene: ENSMUSG00000034645
AA Change: L247P

DomainStartEndE-ValueType
SCOP:d1jdha_ 218 700 2e-11 SMART
Blast:ARM 497 544 1e-5 BLAST
Blast:ARM 547 587 5e-7 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000106690
AA Change: L249P

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102301
Gene: ENSMUSG00000034645
AA Change: L249P

DomainStartEndE-ValueType
SCOP:d1jdha_ 139 621 1e-11 SMART
Blast:ARM 418 465 1e-5 BLAST
Blast:ARM 468 508 1e-7 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000223127
AA Change: L249P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Meta Mutation Damage Score 0.4233 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency 99% (97/98)
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4930578I06Rik G A 14: 63,986,265 R21* probably null Het
9530003J23Rik A G 10: 117,237,730 F66S probably benign Het
Abca15 A G 7: 120,365,786 E757G possibly damaging Het
Abca5 T C 11: 110,301,527 T720A probably benign Het
Actr5 T A 2: 158,632,456 probably null Het
Adgrl3 T C 5: 81,693,716 probably benign Het
Adra1a A G 14: 66,637,792 D72G probably damaging Het
Ahnak G T 19: 9,007,878 L2175F probably benign Het
AK157302 A G 13: 21,495,663 T120A possibly damaging Het
Apol7a G A 15: 77,389,254 A336V probably benign Het
Asic1 C A 15: 99,698,899 H525Q probably benign Het
Atxn7l2 T C 3: 108,204,774 D335G possibly damaging Het
Bpgm G T 6: 34,504,349 R227L possibly damaging Het
Calm4 T A 13: 3,838,320 V142E possibly damaging Het
Catsperg1 A T 7: 29,190,619 L721Q probably damaging Het
Cdh26 A G 2: 178,449,898 I83M probably damaging Het
Cep295 A C 9: 15,322,754 S2249A possibly damaging Het
Cln3 A G 7: 126,580,189 F139L probably damaging Het
Cmpk2 T A 12: 26,478,056 L424Q possibly damaging Het
Col12a1 A T 9: 79,707,848 V53E probably benign Het
Csmd1 G A 8: 15,918,208 R3140C possibly damaging Het
Dagla A G 19: 10,271,558 W11R probably damaging Het
Dbx2 C T 15: 95,624,897 V310M probably benign Het
Disp2 T A 2: 118,792,236 C1150S probably benign Het
Dock3 T C 9: 107,023,788 D326G probably damaging Het
Dph1 G T 11: 75,185,957 probably benign Het
Dyrk1b C A 7: 28,186,634 T594K probably damaging Het
Evx2 C A 2: 74,655,987 A353S probably benign Het
Fam71f1 T A 6: 29,326,577 V231E probably benign Het
Gm4737 T C 16: 46,153,901 E371G probably damaging Het
Gm4788 G A 1: 139,701,846 T799I probably benign Het
Greb1 A C 12: 16,696,442 S1276A probably benign Het
Hhipl1 T A 12: 108,319,402 C490* probably null Het
Hmmr G T 11: 40,715,902 T231K probably damaging Het
Hspa4l A C 3: 40,779,400 E526D probably benign Het
Ibsp A G 5: 104,310,134 E179G probably benign Het
Ift140 C T 17: 25,035,803 A150V probably benign Het
Igf2bp2 A G 16: 22,070,309 S416P probably benign Het
Ighe T C 12: 113,271,743 K294E unknown Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kng2 T A 16: 23,000,594 N231Y possibly damaging Het
Lca5 A T 9: 83,399,739 C331S probably benign Het
Lrrc1 A G 9: 77,472,206 I101T possibly damaging Het
Lrrk2 A T 15: 91,815,416 I2489L probably benign Het
Mapk9 A C 11: 49,863,573 N51T probably benign Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Nek2 T A 1: 191,822,515 V113D probably damaging Het
Nr4a3 C A 4: 48,051,903 A248E probably benign Het
Nrp1 T C 8: 128,502,618 I859T probably damaging Het
Olfm5 A T 7: 104,154,445 Y195* probably null Het
Olfr354 T A 2: 36,907,659 W238R probably damaging Het
Olfr71 T A 4: 43,706,400 H56L possibly damaging Het
Olfr955 A G 9: 39,469,823 L301P probably damaging Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pcnx2 A G 8: 125,839,687 W1006R probably damaging Het
Pdpk1 T C 17: 24,098,171 probably null Het
Ryr2 T A 13: 11,622,952 H3731L probably damaging Het
Sdr16c5 T G 4: 4,016,116 E103D possibly damaging Het
Setdb2 A C 14: 59,417,470 S324A possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc17a8 A T 10: 89,576,626 I499K probably damaging Het
Slc2a9 T A 5: 38,379,942 I389F probably damaging Het
Slc30a1 T C 1: 191,909,424 V394A probably damaging Het
Slc41a2 A G 10: 83,283,728 I390T possibly damaging Het
Slco1a1 A G 6: 141,918,461 probably null Het
Slit2 A G 5: 48,275,674 K1053E possibly damaging Het
Smarca2 T A 19: 26,691,391 L930Q probably damaging Het
Snx6 T C 12: 54,751,789 H387R probably damaging Het
Sox5 A T 6: 143,833,439 M622K possibly damaging Het
Ston1 C A 17: 88,635,281 N38K possibly damaging Het
Strbp C T 2: 37,584,077 V658I probably damaging Het
Strn3 T C 12: 51,610,448 probably null Het
Suco T G 1: 161,859,503 D96A probably benign Het
Suco A G 1: 161,864,032 probably benign Het
Sytl2 A T 7: 90,380,853 probably benign Het
Tmem41b T A 7: 109,981,083 M25L probably benign Het
Tmem41b T A 7: 109,981,085 D91V probably damaging Het
Tmem50b C T 16: 91,583,286 A68T probably damaging Het
Tmprss11e G A 5: 86,707,347 Q400* probably null Het
Tnfsf13b G A 8: 10,031,661 probably null Het
Trappc8 A G 18: 20,837,188 V916A probably damaging Het
Trdn G T 10: 33,474,453 V673F probably damaging Het
Trim28 G T 7: 13,025,784 probably benign Het
Txnrd2 T C 16: 18,472,882 V427A probably damaging Het
Uggt1 T C 1: 36,165,506 probably benign Het
Vmn1r36 A G 6: 66,716,420 L51P probably damaging Het
Vmn1r63 T A 7: 5,803,064 M190L possibly damaging Het
Vmn2r116 T A 17: 23,387,312 N399K probably damaging Het
Vmn2r117 T C 17: 23,475,514 N453S probably benign Het
Wbp1l T A 19: 46,654,670 I370N probably damaging Het
Zfp445 T C 9: 122,852,981 K632E probably benign Het
Zfp850 C T 7: 27,989,394 R463H probably damaging Het
Other mutations in Zyg11a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Zyg11a APN 4 108204902 missense probably damaging 0.99
IGL01517:Zyg11a APN 4 108201194 missense probably null 1.00
IGL01619:Zyg11a APN 4 108205217 missense probably damaging 1.00
IGL02253:Zyg11a APN 4 108183695 missense probably null 0.99
R0090:Zyg11a UTSW 4 108201347 splice site probably benign
R0225:Zyg11a UTSW 4 108204641 missense probably damaging 1.00
R0827:Zyg11a UTSW 4 108210042 splice site probably benign
R1568:Zyg11a UTSW 4 108183646 critical splice donor site probably null
R1752:Zyg11a UTSW 4 108205282 missense possibly damaging 0.81
R2051:Zyg11a UTSW 4 108192047 splice site probably benign
R2358:Zyg11a UTSW 4 108196146 missense possibly damaging 0.94
R3898:Zyg11a UTSW 4 108210194 missense probably damaging 0.99
R4288:Zyg11a UTSW 4 108184469 missense probably damaging 1.00
R4381:Zyg11a UTSW 4 108201320 missense possibly damaging 0.58
R4709:Zyg11a UTSW 4 108205071 missense probably benign 0.00
R4859:Zyg11a UTSW 4 108210190 missense probably damaging 0.98
R5303:Zyg11a UTSW 4 108184432 critical splice donor site probably null
R5349:Zyg11a UTSW 4 108183732 missense probably damaging 1.00
R5363:Zyg11a UTSW 4 108189622 missense probably damaging 1.00
R5517:Zyg11a UTSW 4 108204746 missense possibly damaging 0.94
R6175:Zyg11a UTSW 4 108189681 missense probably benign 0.01
R6254:Zyg11a UTSW 4 108181794 missense probably damaging 1.00
R6678:Zyg11a UTSW 4 108189681 missense probably benign 0.01
R7524:Zyg11a UTSW 4 108192074 missense probably damaging 1.00
R7789:Zyg11a UTSW 4 108183648 missense probably damaging 1.00
R8022:Zyg11a UTSW 4 108189568 critical splice donor site probably null
X0061:Zyg11a UTSW 4 108193993 missense probably damaging 1.00
Z1176:Zyg11a UTSW 4 108201282 missense probably damaging 1.00
Z1177:Zyg11a UTSW 4 108204800 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGTCCCACAAATCGCATGGCAG -3'
(R):5'- TGTTAGACTCAGTCAGCATCCCTCC -3'

Sequencing Primer
(F):5'- GCAGAAAGGATTCCACAGCT -3'
(R):5'- CTCCGAACTCAGGACTAGTG -3'
Posted On2013-07-11