Incidental Mutation 'R7026:Lrfn2'
ID545999
Institutional Source Beutler Lab
Gene Symbol Lrfn2
Ensembl Gene ENSMUSG00000040490
Gene Nameleucine rich repeat and fibronectin type III domain containing 2
Synonyms5730420O05Rik, SALM1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7026 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location48932379-49097588 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 49096977 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 709 (S709R)
Ref Sequence ENSEMBL: ENSMUSP00000047573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046254]
Predicted Effect probably benign
Transcript: ENSMUST00000046254
AA Change: S709R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000047573
Gene: ENSMUSG00000040490
AA Change: S709R

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
LRRNT 20 56 2.9e0 SMART
LRR 75 98 7.36e0 SMART
LRR_TYP 99 122 1.1e-2 SMART
LRR_TYP 123 146 2.2e-2 SMART
LRR 148 171 4.45e1 SMART
LRR_TYP 172 195 1.56e-2 SMART
LRR 196 220 1.06e1 SMART
LRRCT 242 287 5.53e-4 SMART
IGc2 301 366 8e-12 SMART
low complexity region 401 415 N/A INTRINSIC
FN3 420 500 1.52e-1 SMART
transmembrane domain 533 555 N/A INTRINSIC
low complexity region 613 654 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (69/70)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit small spleens, small or no thymi, impaired T cell development, and decreased T cell proliferation in response to mitogen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 A T 19: 43,816,953 M749L probably benign Het
Abcc2 A G 19: 43,830,535 N1321S probably benign Het
Acsm2 T A 7: 119,592,227 V506E probably damaging Het
Add2 G A 6: 86,086,983 R88Q probably benign Het
Adgra3 A G 5: 49,960,741 V1155A probably benign Het
Ahsg T A 16: 22,892,213 D33E probably damaging Het
Alox12b A T 11: 69,157,305 D20V possibly damaging Het
Alppl2 A G 1: 87,089,698 probably null Het
Ankfn1 A G 11: 89,639,577 *49Q probably null Het
Bcl11b T C 12: 107,916,592 D488G probably damaging Het
Bcl2l10 T A 9: 75,351,082 F175L probably benign Het
C2cd3 T A 7: 100,432,092 D127E probably damaging Het
Cacna1c C T 6: 118,637,771 V1311I probably damaging Het
Cd55b A T 1: 130,388,690 I374K probably benign Het
Cfap36 T C 11: 29,222,565 T267A probably benign Het
Cog1 T C 11: 113,649,589 L10P probably damaging Het
Dnah7a T A 1: 53,504,289 M2241L probably benign Het
Dock10 G T 1: 80,501,787 A1809E probably benign Het
Dock7 A T 4: 99,078,919 D255E probably benign Het
Exph5 T C 9: 53,340,428 F123L probably benign Het
Fam92b G A 8: 120,168,585 H193Y probably damaging Het
Fbxw27 C A 9: 109,788,078 K118N possibly damaging Het
Fscb C A 12: 64,471,617 S1025I unknown Het
Get4 C T 5: 139,252,603 R47W possibly damaging Het
Gm14409 T A 2: 177,265,568 I46F probably benign Het
Gm3676 G A 14: 41,644,115 S81F probably benign Het
Gulp1 C T 1: 44,781,085 P251S possibly damaging Het
Hhatl T C 9: 121,788,273 D298G probably benign Het
Hsf2bp T A 17: 32,033,280 K60N possibly damaging Het
Ints4 T A 7: 97,519,154 V625D possibly damaging Het
Iqch T A 9: 63,525,139 K286* probably null Het
Irak1bp1 T A 9: 82,830,031 S2T possibly damaging Het
Kdm3b G A 18: 34,822,464 V1135I possibly damaging Het
Lama3 C A 18: 12,516,548 N181K probably damaging Het
Lrp12 T C 15: 39,880,170 H123R probably damaging Het
Lrp1b A G 2: 41,269,222 S1569P probably damaging Het
Lrp2 T G 2: 69,521,787 Q635P probably damaging Het
Mboat2 T C 12: 24,948,382 probably null Het
Mctp1 A G 13: 76,806,259 T596A probably benign Het
Mroh9 T A 1: 163,060,682 M275L probably benign Het
Ms4a10 A C 19: 10,967,505 probably null Het
Myo9a C T 9: 59,815,334 R560C probably damaging Het
Olfr1348 T A 7: 6,501,821 H135L probably damaging Het
Olfr1461 A G 19: 13,165,415 T134A probably benign Het
Olfr747 A G 14: 50,681,259 I125T probably damaging Het
Ormdl3 A G 11: 98,583,982 V45A possibly damaging Het
Parp4 T C 14: 56,620,592 Y894H probably benign Het
Pigo G A 4: 43,023,380 Q259* probably null Het
Prrc2a G A 17: 35,161,827 P70S unknown Het
Rab3ip A G 10: 116,937,536 I124T probably benign Het
Rap1b A G 10: 117,818,479 I21T probably benign Het
Rasgrf2 T A 13: 91,983,613 S642C probably damaging Het
Rb1 T C 14: 73,298,099 E106G probably benign Het
Reps1 C A 10: 18,107,689 R427S probably damaging Het
Rnf213 A C 11: 119,479,655 H4760P possibly damaging Het
Rtl1 A G 12: 109,593,161 I748T probably damaging Het
Sco1 A T 11: 67,053,857 K102M probably damaging Het
Sec16b T C 1: 157,534,711 M44T possibly damaging Het
Slc7a10 T C 7: 35,198,714 M297T probably damaging Het
Smchd1 T C 17: 71,349,667 H1935R probably benign Het
Sowaha G A 11: 53,479,223 R229W probably damaging Het
Sptlc3 A T 2: 139,537,688 M83L probably benign Het
Tbc1d9 T C 8: 83,241,563 V431A probably benign Het
Tmem98 A G 11: 80,821,388 E217G possibly damaging Het
Trim13 T A 14: 61,605,113 L193* probably null Het
Trp53bp2 T C 1: 182,442,735 S367P probably benign Het
Tsc2 T G 17: 24,626,739 I202L probably damaging Het
Twf2 T A 9: 106,214,880 V312E probably damaging Het
Usp34 G T 11: 23,361,622 L471F probably damaging Het
Vps37c A G 19: 10,706,268 D18G probably damaging Het
Other mutations in Lrfn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01612:Lrfn2 APN 17 49070397 missense possibly damaging 0.81
IGL01989:Lrfn2 APN 17 49071085 missense probably damaging 1.00
IGL03324:Lrfn2 APN 17 49070887 missense probably damaging 1.00
IGL02991:Lrfn2 UTSW 17 49070704 missense probably damaging 1.00
R0306:Lrfn2 UTSW 17 49096255 missense probably damaging 0.99
R0539:Lrfn2 UTSW 17 49071044 missense probably damaging 1.00
R1245:Lrfn2 UTSW 17 49096249 critical splice acceptor site probably null
R1414:Lrfn2 UTSW 17 49070829 missense probably benign 0.01
R1437:Lrfn2 UTSW 17 49071225 missense probably damaging 0.97
R1670:Lrfn2 UTSW 17 49096577 missense probably benign 0.01
R2358:Lrfn2 UTSW 17 49071160 missense possibly damaging 0.92
R3711:Lrfn2 UTSW 17 49071160 missense possibly damaging 0.92
R3712:Lrfn2 UTSW 17 49071160 missense possibly damaging 0.92
R4521:Lrfn2 UTSW 17 49069894 start codon destroyed probably null 0.02
R4532:Lrfn2 UTSW 17 49070536 missense probably damaging 1.00
R4724:Lrfn2 UTSW 17 49070434 missense probably damaging 1.00
R5062:Lrfn2 UTSW 17 49070500 missense probably damaging 1.00
R5066:Lrfn2 UTSW 17 49096420 missense probably damaging 1.00
R5348:Lrfn2 UTSW 17 49096690 missense probably benign
R5673:Lrfn2 UTSW 17 49096597 missense probably benign 0.02
R5900:Lrfn2 UTSW 17 49070263 missense possibly damaging 0.82
R6014:Lrfn2 UTSW 17 49069906 missense possibly damaging 0.96
R6087:Lrfn2 UTSW 17 49071126 missense probably benign
R6224:Lrfn2 UTSW 17 49096351 missense probably damaging 1.00
R6229:Lrfn2 UTSW 17 49097132 missense possibly damaging 0.88
R6342:Lrfn2 UTSW 17 49097000 missense probably benign 0.27
R6408:Lrfn2 UTSW 17 49070626 missense probably damaging 1.00
R7505:Lrfn2 UTSW 17 49096451 missense probably benign 0.14
R7852:Lrfn2 UTSW 17 49069944 missense possibly damaging 0.69
R7918:Lrfn2 UTSW 17 49071184 missense probably damaging 0.99
R8375:Lrfn2 UTSW 17 49096823 missense possibly damaging 0.73
Z1177:Lrfn2 UTSW 17 49070012 frame shift probably null
Z1177:Lrfn2 UTSW 17 49070095 missense probably benign 0.03
Z1177:Lrfn2 UTSW 17 49096715 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGACTTCAGTACCAGCCTG -3'
(R):5'- CCTCAAAGGGCAAGAGCATG -3'

Sequencing Primer
(F):5'- TTCAGTACCAGCCTGGCCAG -3'
(R):5'- TGCCATTGACAGACAGGC -3'
Posted On2019-05-13