Incidental Mutation 'R7027:Tnc'
ID 546024
Institutional Source Beutler Lab
Gene Symbol Tnc
Ensembl Gene ENSMUSG00000028364
Gene Name tenascin C
Synonyms TN, TN-C, hexabrachion, tenascin-C, C130033P17Rik, cytotactin, Hxb
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7027 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 63959785-64047015 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 63984589 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 1484 (F1484L)
Ref Sequence ENSEMBL: ENSMUSP00000102995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030056] [ENSMUST00000107372] [ENSMUST00000107377]
AlphaFold Q80YX1
Predicted Effect probably benign
Transcript: ENSMUST00000030056
SMART Domains Protein: ENSMUSP00000030056
Gene: ENSMUSG00000028364

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 121 138 N/A INTRINSIC
EGF 189 217 1.87e1 SMART
EGF_like 220 248 3.5e1 SMART
EGF 251 280 4.89e0 SMART
EGF 283 311 3.23e0 SMART
EGF_like 314 342 2.98e1 SMART
EGF 345 373 1.87e1 SMART
EGF 376 404 3.97e0 SMART
EGF 407 435 8.52e0 SMART
EGF 438 466 3.01e0 SMART
EGF 469 497 3.46e0 SMART
EGF 500 528 3.71e0 SMART
EGF 531 559 4.32e-1 SMART
EGF 562 590 1.84e1 SMART
EGF 593 621 3.82e-2 SMART
FN3 623 701 8.9e-8 SMART
FN3 712 794 1.53e-6 SMART
FN3 803 884 7.23e-8 SMART
FN3 893 974 1.71e-9 SMART
FN3 985 1062 2.56e-8 SMART
FN3 1074 1152 8.58e-1 SMART
FN3 1165 1245 2.72e-3 SMART
FN3 1256 1334 5.36e-2 SMART
FN3 1347 1427 4.93e0 SMART
FN3 1438 1517 3.4e-4 SMART
FN3 1528 1606 1.55e-7 SMART
FN3 1617 1694 1.53e-6 SMART
FN3 1705 1782 7.75e-8 SMART
FBG 1797 2007 4.08e-124 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107372
AA Change: F1484L

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000102995
Gene: ENSMUSG00000028364
AA Change: F1484L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 121 138 N/A INTRINSIC
EGF 189 217 1.87e1 SMART
EGF_like 220 248 3.5e1 SMART
EGF 251 280 4.89e0 SMART
EGF 283 311 3.23e0 SMART
EGF_like 314 342 2.98e1 SMART
EGF 345 373 1.87e1 SMART
EGF 376 404 3.97e0 SMART
EGF 407 435 8.52e0 SMART
EGF 438 466 3.01e0 SMART
EGF 469 497 3.46e0 SMART
EGF 500 528 3.71e0 SMART
EGF 531 559 4.32e-1 SMART
EGF 562 590 1.84e1 SMART
EGF 593 621 3.82e-2 SMART
FN3 623 701 8.9e-8 SMART
FN3 712 794 1.53e-6 SMART
FN3 803 884 7.23e-8 SMART
FN3 893 974 1.71e-9 SMART
FN3 985 1062 2.56e-8 SMART
FN3 1074 1152 8.58e-1 SMART
FN3 1165 1245 2.72e-3 SMART
FN3 1256 1334 5.36e-2 SMART
FN3 1347 1427 4.93e0 SMART
FN3 1438 1517 2.75e0 SMART
FN3 1529 1608 3.4e-4 SMART
FN3 1619 1697 1.55e-7 SMART
FN3 1708 1785 1.53e-6 SMART
FN3 1796 1873 7.75e-8 SMART
FBG 1888 2098 4.08e-124 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107377
SMART Domains Protein: ENSMUSP00000103000
Gene: ENSMUSG00000028364

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 121 138 N/A INTRINSIC
EGF 189 217 1.87e1 SMART
EGF_like 220 248 3.5e1 SMART
EGF 251 280 4.89e0 SMART
EGF 283 311 3.23e0 SMART
EGF_like 314 342 2.98e1 SMART
EGF 345 373 1.87e1 SMART
EGF 376 404 3.97e0 SMART
EGF 407 435 8.52e0 SMART
EGF 438 466 3.01e0 SMART
EGF 469 497 3.46e0 SMART
EGF 500 528 3.71e0 SMART
EGF 531 559 4.32e-1 SMART
EGF 562 590 1.84e1 SMART
EGF 593 621 3.82e-2 SMART
FN3 623 701 8.9e-8 SMART
FN3 712 794 1.53e-6 SMART
FN3 803 884 7.23e-8 SMART
FN3 893 974 1.71e-9 SMART
FN3 985 1062 2.56e-8 SMART
FN3 1074 1152 8.58e-1 SMART
FN3 1165 1245 2.72e-3 SMART
FN3 1256 1334 5.36e-2 SMART
FN3 1347 1427 4.93e0 SMART
FN3 1438 1517 3.4e-4 SMART
FN3 1528 1606 1.55e-7 SMART
FN3 1617 1694 1.53e-6 SMART
FN3 1705 1782 7.75e-8 SMART
FBG 1797 2007 4.08e-124 SMART
Meta Mutation Damage Score 0.0774 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (85/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an extracellular matrix protein with a spatially and temporally restricted tissue distribution. This protein is homohexameric with disulfide-linked subunits, and contains multiple EGF-like and fibronectin type-III domains. It is implicated in guidance of migrating neurons as well as axons during development, synaptic plasticity, and neuronal regeneration. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for several different targeted mutations show variable behavioral and nervous system phenotypes such as abnormal circadian rhythm, anxiety behavior, novelty-induced activity, swimming, impaired synaptic plasticity, long term potentiation and serotonin and dopamine neurotransmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik A G 2: 85,485,527 Y440H probably damaging Het
Acoxl A T 2: 128,010,083 M102L probably benign Het
Adcy10 A G 1: 165,518,246 E288G probably damaging Het
Agap1 A G 1: 89,888,722 H748R probably benign Het
Ahsg T C 16: 22,892,257 L48P probably damaging Het
Ankrd27 A G 7: 35,612,526 T394A probably benign Het
Apc T G 18: 34,312,076 V657G probably damaging Het
Arl2 T C 19: 6,141,089 T5A probably benign Het
B020011L13Rik A G 1: 117,801,450 Y229C probably benign Het
B3gnt5 T A 16: 19,769,990 S320T probably damaging Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
BC107364 T G 3: 96,440,741 R77S unknown Het
Brox G A 1: 183,284,186 P206L possibly damaging Het
Ccrl2 T C 9: 111,055,885 K182E probably benign Het
Cd19 A G 7: 126,410,499 V465A possibly damaging Het
Chrdl2 A T 7: 100,022,033 Q126H probably damaging Het
Cnbd1 G A 4: 18,862,063 P376S probably benign Het
Cobll1 A G 2: 65,089,503 S1194P probably benign Het
Col6a4 T C 9: 106,067,014 Y1087C probably damaging Het
Col9a2 G A 4: 121,044,019 probably null Het
Cyp4v3 A G 8: 45,310,252 S341P possibly damaging Het
Dnah7a T A 1: 53,631,506 Y529F probably benign Het
Eif3b C T 5: 140,425,288 R165W probably damaging Het
Erlec1 C A 11: 30,950,790 C126F probably damaging Het
Fat2 T C 11: 55,269,433 T3285A probably benign Het
Fat2 G A 11: 55,281,851 R2679* probably null Het
Fbxo31 T C 8: 121,578,485 T91A probably damaging Het
Fkbp5 A G 17: 28,412,063 Y243H probably damaging Het
Flcn C T 11: 59,795,806 V374M probably damaging Het
Fndc5 A G 4: 129,139,523 M128V probably benign Het
Gal3st1 A G 11: 3,999,002 D403G probably damaging Het
Garem1 T C 18: 21,129,994 N588D probably benign Het
Gas1 T C 13: 60,176,233 T196A probably damaging Het
Gcn1l1 T C 5: 115,616,546 probably null Het
Gprc5d T G 6: 135,116,648 Q87P probably damaging Het
Grm1 A G 10: 10,719,595 L763P probably damaging Het
Hivep2 G T 10: 14,149,577 K2378N probably damaging Het
Hivep2 G T 10: 14,149,578 D2379Y probably damaging Het
Itgad A G 7: 128,182,989 Y199C probably damaging Het
Itm2c A G 1: 85,906,485 I174V probably benign Het
Khdrbs2 A G 1: 32,414,916 S128G probably benign Het
Map3k9 T C 12: 81,730,624 T528A probably benign Het
Mmp11 G A 10: 75,932,396 probably benign Het
Mycbpap T A 11: 94,514,614 I30F probably damaging Het
Nfya T C 17: 48,389,312 T335A probably benign Het
Npat T A 9: 53,569,916 S1008T possibly damaging Het
Olfr1145 A G 2: 87,810,716 T299A possibly damaging Het
Olfr121 G A 17: 37,752,409 C185Y probably damaging Het
Olfr494 A T 7: 108,368,350 M287L probably damaging Het
Olfr818 C T 10: 129,945,172 A297T possibly damaging Het
Osbpl10 T C 9: 115,223,698 V613A probably damaging Het
Pcdhga8 T C 18: 37,727,111 W407R probably benign Het
Pcdhgb4 A G 18: 37,721,362 D270G probably damaging Het
Pde2a A C 7: 101,511,597 E918D probably damaging Het
Plekhg5 A G 4: 152,113,974 D873G probably benign Het
Pno1 A T 11: 17,208,880 S173T possibly damaging Het
Ppfia3 A G 7: 45,354,736 I494T possibly damaging Het
Prkrip1 C A 5: 136,181,413 probably benign Het
Psma5 A G 3: 108,265,168 I67V probably benign Het
Reep6 G A 10: 80,333,965 probably null Het
Rtl1 CTCTTCTTCTTCACCATCTTCCTCCTCCTCCCCTTCTTCTTCTTCACCATCTTCCTCCTCCTCCCCTTCTTCTTCTTCACCATCTTCCTCCTCCTC CTCTTCTTCTTCACCATCTTCCTCCTCCTCCCCTTCTTCTTCTTCACCATCTTCCTCCTCCTC 12: 109,591,414 probably benign Het
Scyl2 C G 10: 89,645,461 probably null Het
Sdk1 T A 5: 142,096,726 probably null Het
Senp5 C A 16: 31,989,295 K380N probably benign Het
Slc22a14 A T 9: 119,231,215 probably null Het
Slc26a5 T A 5: 21,816,974 T485S possibly damaging Het
Slc44a5 T C 3: 154,253,719 I349T probably benign Het
Smarca5 T C 8: 80,736,726 E71G probably benign Het
Smok2a A T 17: 13,225,779 H81L probably damaging Het
Snrnp200 A G 2: 127,217,272 D388G probably benign Het
Tank T C 2: 61,653,422 V404A probably benign Het
Tek A G 4: 94,865,510 D1063G probably damaging Het
Tfap2a C T 13: 40,733,674 C16Y probably benign Het
Tmc1 A G 19: 20,940,903 probably null Het
Tnfsf13 T A 11: 69,685,132 probably null Het
Tnrc6c T A 11: 117,733,618 S919T probably damaging Het
Trim17 C A 11: 58,968,616 Q219K probably benign Het
Trim5 T A 7: 104,265,668 H389L probably benign Het
Trio T A 15: 27,805,654 M583L possibly damaging Het
Ttll10 A T 4: 156,035,801 H389Q possibly damaging Het
Usp24 T C 4: 106,362,244 S546P probably benign Het
Vmn1r19 T A 6: 57,404,490 Y9* probably null Het
Vmn2r50 T A 7: 10,047,612 D402V probably damaging Het
Vmn2r93 C A 17: 18,313,286 A484E probably benign Het
Vps13a T C 19: 16,664,664 T2200A probably benign Het
Wdr36 T A 18: 32,841,905 H103Q probably benign Het
Zfp534 G A 4: 147,675,210 T334I possibly damaging Het
Zfp804b C T 5: 6,770,372 S897N probably benign Het
Other mutations in Tnc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Tnc APN 4 64016824 splice site probably benign
IGL00531:Tnc APN 4 63971153 splice site probably benign
IGL00674:Tnc APN 4 63965607 missense probably damaging 1.00
IGL01015:Tnc APN 4 64017334 missense probably benign 0.19
IGL01090:Tnc APN 4 64000080 missense probably damaging 1.00
IGL01310:Tnc APN 4 64013077 missense probably benign 0.03
IGL01331:Tnc APN 4 63982875 missense probably damaging 0.99
IGL01393:Tnc APN 4 64014054 splice site probably benign
IGL01411:Tnc APN 4 64000722 missense probably damaging 0.96
IGL01472:Tnc APN 4 64006419 missense probably benign 0.00
IGL01552:Tnc APN 4 63970408 missense probably damaging 1.00
IGL01661:Tnc APN 4 63970307 splice site probably benign
IGL01669:Tnc APN 4 64000701 missense probably damaging 1.00
IGL01912:Tnc APN 4 64008740 missense probably damaging 1.00
IGL02028:Tnc APN 4 63966672 splice site probably benign
IGL02100:Tnc APN 4 64000161 missense possibly damaging 0.84
IGL02549:Tnc APN 4 64015072 missense probably damaging 1.00
IGL02642:Tnc APN 4 63965579 splice site probably benign
IGL02712:Tnc APN 4 63975256 missense probably damaging 1.00
IGL02876:Tnc APN 4 64015101 missense possibly damaging 0.56
IGL02886:Tnc APN 4 64000107 missense probably damaging 0.96
IGL02972:Tnc APN 4 63976478 missense probably benign 0.11
IGL03073:Tnc APN 4 63971224 missense possibly damaging 0.58
IGL03116:Tnc APN 4 64014033 missense probably damaging 1.00
IGL03181:Tnc APN 4 63967306 missense possibly damaging 0.95
IGL03358:Tnc APN 4 64017615 nonsense probably null
tancredo UTSW 4 63993297 nonsense probably null
BB009:Tnc UTSW 4 64008620 missense probably benign
BB019:Tnc UTSW 4 64008620 missense probably benign
P0020:Tnc UTSW 4 64008857 missense possibly damaging 0.63
PIT4377001:Tnc UTSW 4 64017736 missense probably damaging 1.00
PIT4403001:Tnc UTSW 4 63964667 missense probably damaging 1.00
PIT4468001:Tnc UTSW 4 63964667 missense probably damaging 1.00
R0243:Tnc UTSW 4 63970420 missense probably damaging 0.98
R0362:Tnc UTSW 4 64017442 missense probably damaging 1.00
R0410:Tnc UTSW 4 64007694 missense probably benign 0.00
R0420:Tnc UTSW 4 64000159 missense probably benign 0.00
R0540:Tnc UTSW 4 64020455 missense probably damaging 1.00
R0650:Tnc UTSW 4 64008734 missense probably benign 0.00
R1019:Tnc UTSW 4 63962082 missense probably damaging 1.00
R1102:Tnc UTSW 4 64020468 missense probably benign 0.05
R1126:Tnc UTSW 4 64018120 missense probably damaging 0.99
R1141:Tnc UTSW 4 64013994 missense probably damaging 1.00
R1142:Tnc UTSW 4 64013994 missense probably damaging 1.00
R1307:Tnc UTSW 4 64008859 missense probably damaging 0.98
R1322:Tnc UTSW 4 64013994 missense probably damaging 1.00
R1414:Tnc UTSW 4 63965695 splice site probably benign
R1470:Tnc UTSW 4 63966574 missense probably damaging 1.00
R1470:Tnc UTSW 4 63966574 missense probably damaging 1.00
R1499:Tnc UTSW 4 63964754 missense probably benign 0.15
R1506:Tnc UTSW 4 64007684 missense possibly damaging 0.90
R1597:Tnc UTSW 4 64006384 missense probably benign
R1750:Tnc UTSW 4 63972735 missense probably damaging 1.00
R1765:Tnc UTSW 4 64013994 missense probably damaging 1.00
R1783:Tnc UTSW 4 64018096 missense probably damaging 0.98
R1808:Tnc UTSW 4 63999931 missense probably damaging 1.00
R1903:Tnc UTSW 4 64000062 missense probably benign 0.00
R1932:Tnc UTSW 4 63993025 critical splice donor site probably null
R1941:Tnc UTSW 4 64014964 missense probably damaging 1.00
R1983:Tnc UTSW 4 63984630 missense possibly damaging 0.95
R2024:Tnc UTSW 4 63964621 missense probably damaging 1.00
R2075:Tnc UTSW 4 63995666 missense possibly damaging 0.94
R2327:Tnc UTSW 4 63975238 missense possibly damaging 0.78
R2444:Tnc UTSW 4 64014963 missense probably damaging 1.00
R2982:Tnc UTSW 4 64020519 missense possibly damaging 0.81
R3874:Tnc UTSW 4 64008710 missense probably damaging 1.00
R4110:Tnc UTSW 4 64014951 missense probably damaging 1.00
R4360:Tnc UTSW 4 64016924 missense probably benign 0.35
R4371:Tnc UTSW 4 63970351 missense probably damaging 1.00
R4434:Tnc UTSW 4 64007829 missense possibly damaging 0.91
R4438:Tnc UTSW 4 64007829 missense possibly damaging 0.91
R4570:Tnc UTSW 4 63995672 missense probably damaging 0.99
R4595:Tnc UTSW 4 63995745 missense probably damaging 1.00
R4749:Tnc UTSW 4 63995639 missense possibly damaging 0.56
R4756:Tnc UTSW 4 63967343 missense probably damaging 0.99
R4824:Tnc UTSW 4 64017620 nonsense probably null
R4957:Tnc UTSW 4 63976556 missense probably damaging 1.00
R4977:Tnc UTSW 4 64006248 missense possibly damaging 0.82
R5001:Tnc UTSW 4 63984489 missense probably damaging 1.00
R5001:Tnc UTSW 4 64000062 missense probably benign 0.16
R5015:Tnc UTSW 4 64006502 missense probably damaging 1.00
R5049:Tnc UTSW 4 64017986 missense probably damaging 1.00
R5066:Tnc UTSW 4 63975229 missense probably damaging 0.96
R5073:Tnc UTSW 4 64020411 missense probably damaging 1.00
R5116:Tnc UTSW 4 63967215 critical splice donor site probably null
R5195:Tnc UTSW 4 63967252 missense probably damaging 1.00
R5200:Tnc UTSW 4 63971278 missense probably damaging 1.00
R5221:Tnc UTSW 4 63993297 nonsense probably null
R5237:Tnc UTSW 4 63962096 missense probably damaging 1.00
R5265:Tnc UTSW 4 63993206 missense probably benign 0.00
R5275:Tnc UTSW 4 63964730 nonsense probably null
R5346:Tnc UTSW 4 64008655 missense probably benign
R5409:Tnc UTSW 4 63966536 missense probably damaging 1.00
R5409:Tnc UTSW 4 64007417 missense probably damaging 1.00
R5469:Tnc UTSW 4 64013925 splice site probably null
R5518:Tnc UTSW 4 64017679 missense probably damaging 1.00
R5560:Tnc UTSW 4 64008709 missense probably damaging 1.00
R5588:Tnc UTSW 4 64006422 missense possibly damaging 0.57
R5686:Tnc UTSW 4 64007730 splice site probably null
R5686:Tnc UTSW 4 64008795 missense possibly damaging 0.78
R5837:Tnc UTSW 4 64013214 missense probably damaging 1.00
R5976:Tnc UTSW 4 64018166 missense probably benign 0.17
R6156:Tnc UTSW 4 63970352 missense probably damaging 1.00
R6182:Tnc UTSW 4 64008796 missense probably damaging 0.99
R6360:Tnc UTSW 4 64000733 missense probably damaging 1.00
R6416:Tnc UTSW 4 64007816 missense probably benign 0.05
R6778:Tnc UTSW 4 63995598 missense probably benign 0.12
R6798:Tnc UTSW 4 63965604 missense probably benign 0.02
R6799:Tnc UTSW 4 63965604 missense probably benign 0.02
R6943:Tnc UTSW 4 63982745 missense probably damaging 0.97
R7183:Tnc UTSW 4 64013128 missense probably damaging 1.00
R7204:Tnc UTSW 4 63971155 splice site probably null
R7317:Tnc UTSW 4 63972722 missense probably damaging 0.99
R7323:Tnc UTSW 4 63971232 missense probably damaging 0.96
R7327:Tnc UTSW 4 63964762 splice site probably null
R7382:Tnc UTSW 4 64014043 nonsense probably null
R7399:Tnc UTSW 4 64020657 start gained probably benign
R7479:Tnc UTSW 4 64017628 missense possibly damaging 0.95
R7585:Tnc UTSW 4 64020411 missense probably damaging 1.00
R7932:Tnc UTSW 4 64008620 missense probably benign
R7947:Tnc UTSW 4 64017343 missense probably damaging 1.00
R7974:Tnc UTSW 4 64000724 missense possibly damaging 0.84
R7991:Tnc UTSW 4 64008746 missense probably benign 0.42
R8004:Tnc UTSW 4 63984657 missense probably benign 0.04
R8080:Tnc UTSW 4 63976469 missense possibly damaging 0.52
R8109:Tnc UTSW 4 64008763 missense probably benign 0.11
R8145:Tnc UTSW 4 64017479 missense probably benign
R8340:Tnc UTSW 4 64007799 missense probably damaging 1.00
R8360:Tnc UTSW 4 63967274 missense probably benign 0.00
R8671:Tnc UTSW 4 64017446 missense probably damaging 1.00
R8691:Tnc UTSW 4 63962076 missense probably damaging 1.00
R8759:Tnc UTSW 4 64006264 missense possibly damaging 0.86
R8864:Tnc UTSW 4 63993059 missense probably damaging 0.98
R8927:Tnc UTSW 4 64007358 missense probably damaging 1.00
R8928:Tnc UTSW 4 64007358 missense probably damaging 1.00
R8949:Tnc UTSW 4 64008850 missense probably damaging 1.00
R8956:Tnc UTSW 4 64000733 missense probably damaging 1.00
R9016:Tnc UTSW 4 64017094 missense probably benign 0.23
R9049:Tnc UTSW 4 64000010 missense possibly damaging 0.83
R9097:Tnc UTSW 4 63970385 missense possibly damaging 0.62
R9114:Tnc UTSW 4 63972736 missense probably benign 0.03
R9151:Tnc UTSW 4 64020449 missense possibly damaging 0.46
R9488:Tnc UTSW 4 63995705 missense probably damaging 0.99
R9537:Tnc UTSW 4 63966584 missense probably damaging 0.99
R9666:Tnc UTSW 4 64007808 missense probably damaging 1.00
R9700:Tnc UTSW 4 64014949 missense probably damaging 0.99
R9703:Tnc UTSW 4 63971175 missense probably benign 0.00
R9771:Tnc UTSW 4 64007363 missense probably damaging 1.00
S24628:Tnc UTSW 4 64018012 missense probably damaging 1.00
Z1177:Tnc UTSW 4 63960544 critical splice acceptor site probably null
Z1177:Tnc UTSW 4 64007426 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTTAGAAACCACAGGGATCCG -3'
(R):5'- CAGTGCTGCTAACCTGAGTC -3'

Sequencing Primer
(F):5'- GGGATCCGAAGACAGACTACAC -3'
(R):5'- AGTGCTGCTAACCTGAGTCATTTTC -3'
Posted On 2019-05-13