Incidental Mutation 'R7027:Tek'
ID546025
Institutional Source Beutler Lab
Gene Symbol Tek
Ensembl Gene ENSMUSG00000006386
Gene NameTEK receptor tyrosine kinase
SynonymsCd202b, Hyk, tie-2, Tie2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7027 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location94739289-94874976 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94865510 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1063 (D1063G)
Ref Sequence ENSEMBL: ENSMUSP00000099862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071168] [ENSMUST00000073939] [ENSMUST00000102798]
Predicted Effect probably damaging
Transcript: ENSMUST00000071168
AA Change: D1062G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071162
Gene: ENSMUSG00000006386
AA Change: D1062G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Ig_Tie2_1 23 118 1.2e-57 PFAM
IG_like 128 209 6.52e0 SMART
EGF_Lam 227 264 1.26e-2 SMART
EGF 267 299 2.2e1 SMART
internal_repeat_1 302 346 4.35e-7 PROSPERO
IG_like 356 442 3.29e1 SMART
FN3 445 526 2.11e0 SMART
FN3 541 624 9.77e-5 SMART
FN3 638 720 1.18e-12 SMART
transmembrane domain 747 769 N/A INTRINSIC
TyrKc 822 1090 1.9e-138 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000073939
AA Change: D1012G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073595
Gene: ENSMUSG00000006386
AA Change: D1012G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Ig_Tie2_1 23 118 7.1e-58 PFAM
EGF_Lam 176 213 1.26e-2 SMART
EGF 216 248 2.2e1 SMART
internal_repeat_1 251 295 4.22e-7 PROSPERO
FN3 394 475 2.11e0 SMART
FN3 490 573 9.77e-5 SMART
FN3 587 669 1.18e-12 SMART
transmembrane domain 696 718 N/A INTRINSIC
TyrKc 772 1040 1.9e-138 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102798
AA Change: D1063G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099862
Gene: ENSMUSG00000006386
AA Change: D1063G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Ig_Tie2_1 24 118 5e-44 PFAM
IG_like 128 209 6.52e0 SMART
EGF_Lam 227 264 1.26e-2 SMART
EGF 267 299 2.2e1 SMART
internal_repeat_1 302 346 4.36e-7 PROSPERO
IG_like 356 442 3.29e1 SMART
FN3 445 526 2.11e0 SMART
FN3 541 624 9.77e-5 SMART
FN3 638 720 1.18e-12 SMART
transmembrane domain 747 769 N/A INTRINSIC
TyrKc 823 1091 1.9e-138 SMART
Meta Mutation Damage Score 0.5239 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (85/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor that belongs to the protein tyrosine kinase Tie2 family. The encoded protein possesses a unique extracellular region that contains two immunoglobulin-like domains, three epidermal growth factor (EGF)-like domains and three fibronectin type III repeats. The ligand angiopoietin-1 binds to this receptor and mediates a signaling pathway that functions in embryonic vascular development. Mutations in this gene are associated with inherited venous malformations of the skin and mucous membranes. Alternative splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality during organogenesis, impaired vascular branching in the embryo and yolk sac, abnormal cardiac development, and in some cases hemorrhages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik A G 2: 85,485,527 Y440H probably damaging Het
Acoxl A T 2: 128,010,083 M102L probably benign Het
Adcy10 A G 1: 165,518,246 E288G probably damaging Het
Agap1 A G 1: 89,888,722 H748R probably benign Het
Ahsg T C 16: 22,892,257 L48P probably damaging Het
Ankrd27 A G 7: 35,612,526 T394A probably benign Het
Apc T G 18: 34,312,076 V657G probably damaging Het
Arl2 T C 19: 6,141,089 T5A probably benign Het
B020011L13Rik A G 1: 117,801,450 Y229C probably benign Het
B3gnt5 T A 16: 19,769,990 S320T probably damaging Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
BC107364 T G 3: 96,440,741 R77S unknown Het
Brox G A 1: 183,284,186 P206L possibly damaging Het
Ccrl2 T C 9: 111,055,885 K182E probably benign Het
Cd19 A G 7: 126,410,499 V465A possibly damaging Het
Chrdl2 A T 7: 100,022,033 Q126H probably damaging Het
Cnbd1 G A 4: 18,862,063 P376S probably benign Het
Cobll1 A G 2: 65,089,503 S1194P probably benign Het
Col6a4 T C 9: 106,067,014 Y1087C probably damaging Het
Col9a2 G A 4: 121,044,019 probably null Het
Cyp4v3 A G 8: 45,310,252 S341P possibly damaging Het
Dnah7a T A 1: 53,631,506 Y529F probably benign Het
Eif3b C T 5: 140,425,288 R165W probably damaging Het
Erlec1 C A 11: 30,950,790 C126F probably damaging Het
Fat2 T C 11: 55,269,433 T3285A probably benign Het
Fat2 G A 11: 55,281,851 R2679* probably null Het
Fbxo31 T C 8: 121,578,485 T91A probably damaging Het
Fkbp5 A G 17: 28,412,063 Y243H probably damaging Het
Flcn C T 11: 59,795,806 V374M probably damaging Het
Fndc5 A G 4: 129,139,523 M128V probably benign Het
Gal3st1 A G 11: 3,999,002 D403G probably damaging Het
Garem1 T C 18: 21,129,994 N588D probably benign Het
Gas1 T C 13: 60,176,233 T196A probably damaging Het
Gcn1l1 T C 5: 115,616,546 probably null Het
Gprc5d T G 6: 135,116,648 Q87P probably damaging Het
Grm1 A G 10: 10,719,595 L763P probably damaging Het
Hivep2 G T 10: 14,149,577 K2378N probably damaging Het
Hivep2 G T 10: 14,149,578 D2379Y probably damaging Het
Itgad A G 7: 128,182,989 Y199C probably damaging Het
Itm2c A G 1: 85,906,485 I174V probably benign Het
Khdrbs2 A G 1: 32,414,916 S128G probably benign Het
Map3k9 T C 12: 81,730,624 T528A probably benign Het
Mmp11 G A 10: 75,932,396 probably benign Het
Mycbpap T A 11: 94,514,614 I30F probably damaging Het
Nfya T C 17: 48,389,312 T335A probably benign Het
Npat T A 9: 53,569,916 S1008T possibly damaging Het
Olfr1145 A G 2: 87,810,716 T299A possibly damaging Het
Olfr121 G A 17: 37,752,409 C185Y probably damaging Het
Olfr494 A T 7: 108,368,350 M287L probably damaging Het
Olfr818 C T 10: 129,945,172 A297T possibly damaging Het
Osbpl10 T C 9: 115,223,698 V613A probably damaging Het
Pcdhga8 T C 18: 37,727,111 W407R probably benign Het
Pcdhgb4 A G 18: 37,721,362 D270G probably damaging Het
Pde2a A C 7: 101,511,597 E918D probably damaging Het
Plekhg5 A G 4: 152,113,974 D873G probably benign Het
Pno1 A T 11: 17,208,880 S173T possibly damaging Het
Ppfia3 A G 7: 45,354,736 I494T possibly damaging Het
Prkrip1 C A 5: 136,181,413 probably benign Het
Psma5 A G 3: 108,265,168 I67V probably benign Het
Reep6 G A 10: 80,333,965 probably null Het
Rtl1 CTCTTCTTCTTCACCATCTTCCTCCTCCTCCCCTTCTTCTTCTTCACCATCTTCCTCCTCCTCCCCTTCTTCTTCTTCACCATCTTCCTCCTCCTC CTCTTCTTCTTCACCATCTTCCTCCTCCTCCCCTTCTTCTTCTTCACCATCTTCCTCCTCCTC 12: 109,591,414 probably benign Het
Scyl2 C G 10: 89,645,461 probably null Het
Sdk1 T A 5: 142,096,726 probably null Het
Senp5 C A 16: 31,989,295 K380N probably benign Het
Slc22a14 A T 9: 119,231,215 probably null Het
Slc26a5 T A 5: 21,816,974 T485S possibly damaging Het
Slc44a5 T C 3: 154,253,719 I349T probably benign Het
Smarca5 T C 8: 80,736,726 E71G probably benign Het
Smok2a A T 17: 13,225,779 H81L probably damaging Het
Snrnp200 A G 2: 127,217,272 D388G probably benign Het
Tank T C 2: 61,653,422 V404A probably benign Het
Tfap2a C T 13: 40,733,674 C16Y probably benign Het
Tmc1 A G 19: 20,940,903 probably null Het
Tnc A G 4: 63,984,589 F1484L probably benign Het
Tnfsf13 T A 11: 69,685,132 probably null Het
Tnrc6c T A 11: 117,733,618 S919T probably damaging Het
Trim17 C A 11: 58,968,616 Q219K probably benign Het
Trim5 T A 7: 104,265,668 H389L probably benign Het
Trio T A 15: 27,805,654 M583L possibly damaging Het
Ttll10 A T 4: 156,035,801 H389Q possibly damaging Het
Usp24 T C 4: 106,362,244 S546P probably benign Het
Vmn1r19 T A 6: 57,404,490 Y9* probably null Het
Vmn2r50 T A 7: 10,047,612 D402V probably damaging Het
Vmn2r93 C A 17: 18,313,286 A484E probably benign Het
Vps13a T C 19: 16,664,664 T2200A probably benign Het
Wdr36 T A 18: 32,841,905 H103Q probably benign Het
Zfp534 G A 4: 147,675,210 T334I possibly damaging Het
Zfp804b C T 5: 6,770,372 S897N probably benign Het
Other mutations in Tek
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Tek APN 4 94827301 missense probably benign 0.03
IGL00805:Tek APN 4 94798719 missense probably damaging 1.00
IGL00806:Tek APN 4 94798719 missense probably damaging 1.00
IGL00807:Tek APN 4 94798719 missense probably damaging 1.00
IGL00870:Tek APN 4 94873081 nonsense probably null
IGL01348:Tek APN 4 94859658 missense probably damaging 1.00
IGL01398:Tek APN 4 94849777 missense probably damaging 1.00
IGL01683:Tek APN 4 94858911 missense probably damaging 1.00
IGL01827:Tek APN 4 94739645 missense probably benign 0.24
IGL02063:Tek APN 4 94739645 missense probably benign 0.24
IGL02218:Tek APN 4 94855337 missense probably damaging 1.00
IGL02502:Tek APN 4 94853581 critical splice donor site probably null
IGL02852:Tek APN 4 94855324 missense probably damaging 1.00
IGL02995:Tek APN 4 94739640 utr 5 prime probably benign
IGL03182:Tek APN 4 94851765 missense probably damaging 1.00
IGL03247:Tek APN 4 94865443 missense possibly damaging 0.85
IGL03014:Tek UTSW 4 94827263 missense probably benign 0.05
R0022:Tek UTSW 4 94837272 missense probably damaging 0.98
R0373:Tek UTSW 4 94804341 missense probably damaging 1.00
R0479:Tek UTSW 4 94804312 missense probably benign 0.01
R1178:Tek UTSW 4 94804287 missense probably damaging 1.00
R1289:Tek UTSW 4 94804830 missense probably damaging 1.00
R1331:Tek UTSW 4 94739706 splice site probably benign
R1502:Tek UTSW 4 94781102 missense probably damaging 1.00
R1606:Tek UTSW 4 94849767 missense probably damaging 0.99
R2073:Tek UTSW 4 94827729 missense probably benign 0.01
R2075:Tek UTSW 4 94827729 missense probably benign 0.01
R2230:Tek UTSW 4 94811336 missense probably damaging 1.00
R2851:Tek UTSW 4 94820224 missense probably benign 0.30
R2852:Tek UTSW 4 94820224 missense probably benign 0.30
R3775:Tek UTSW 4 94804312 missense probably benign 0.01
R3845:Tek UTSW 4 94804872 missense probably damaging 1.00
R4114:Tek UTSW 4 94849683 missense probably damaging 0.99
R4115:Tek UTSW 4 94849683 missense probably damaging 0.99
R4273:Tek UTSW 4 94829970 missense probably damaging 1.00
R4425:Tek UTSW 4 94863667 missense probably damaging 1.00
R4488:Tek UTSW 4 94849756 missense possibly damaging 0.72
R4579:Tek UTSW 4 94863666 nonsense probably null
R4623:Tek UTSW 4 94863661 missense probably damaging 1.00
R4651:Tek UTSW 4 94780884 missense probably damaging 1.00
R4652:Tek UTSW 4 94780884 missense probably damaging 1.00
R4723:Tek UTSW 4 94799160 missense possibly damaging 0.71
R5059:Tek UTSW 4 94804314 missense probably benign 0.10
R5652:Tek UTSW 4 94855324 missense probably damaging 1.00
R5793:Tek UTSW 4 94820096 missense probably benign 0.01
R5855:Tek UTSW 4 94853553 missense probably damaging 1.00
R5912:Tek UTSW 4 94798640 missense probably damaging 1.00
R6537:Tek UTSW 4 94837324 missense probably benign 0.19
R6727:Tek UTSW 4 94853495 nonsense probably null
R6835:Tek UTSW 4 94853434 missense possibly damaging 0.94
R6883:Tek UTSW 4 94837189 missense possibly damaging 0.89
R6887:Tek UTSW 4 94804944 missense probably damaging 1.00
R7108:Tek UTSW 4 94853487 missense probably damaging 1.00
R7121:Tek UTSW 4 94811410 missense probably benign 0.19
R7220:Tek UTSW 4 94804304 missense probably damaging 1.00
R7346:Tek UTSW 4 94827296 missense probably benign
R7417:Tek UTSW 4 94811345 missense probably benign
R7465:Tek UTSW 4 94827826 critical splice donor site probably null
R7818:Tek UTSW 4 94827716 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- GAGGCACGTACCCTCTATCTTC -3'
(R):5'- TCAAGAGCTGTGCCTTAACC -3'

Sequencing Primer
(F):5'- CTCCCTCCTCACTGCTTAGCAC -3'
(R):5'- CTCTCCTAGATGTAAGTAGCAGGC -3'
Posted On2019-05-13