Incidental Mutation 'R7027:Osbpl10'
ID546054
Institutional Source Beutler Lab
Gene Symbol Osbpl10
Ensembl Gene ENSMUSG00000040875
Gene Nameoxysterol binding protein-like 10
SynonymsC820004B04Rik, OPR-10, 4933433D06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7027 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location114978569-115232225 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115223698 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 613 (V613A)
Ref Sequence ENSEMBL: ENSMUSP00000138287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046627] [ENSMUST00000182199] [ENSMUST00000182384] [ENSMUST00000183104]
Predicted Effect probably damaging
Transcript: ENSMUST00000046627
AA Change: V438A

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038013
Gene: ENSMUSG00000040875
AA Change: V438A

DomainStartEndE-ValueType
low complexity region 95 116 N/A INTRINSIC
Pfam:Oxysterol_BP 229 535 7.8e-70 PFAM
Pfam:Oxysterol_BP 532 589 1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182199
SMART Domains Protein: ENSMUSP00000138206
Gene: ENSMUSG00000040875

DomainStartEndE-ValueType
Blast:PH 1 36 8e-19 BLAST
PDB:2D9X|A 1 42 2e-8 PDB
SCOP:d1ki1b2 10 42 7e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182384
AA Change: V474A

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138552
Gene: ENSMUSG00000040875
AA Change: V474A

DomainStartEndE-ValueType
Blast:PH 1 36 8e-16 BLAST
PDB:2D9X|A 2 46 6e-7 PDB
SCOP:d1ki1b2 10 42 9e-3 SMART
low complexity region 131 152 N/A INTRINSIC
Pfam:Oxysterol_BP 262 626 1.5e-72 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000183104
AA Change: V613A

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138287
Gene: ENSMUSG00000040875
AA Change: V613A

DomainStartEndE-ValueType
low complexity region 4 75 N/A INTRINSIC
PH 77 175 2.72e-15 SMART
low complexity region 270 291 N/A INTRINSIC
Pfam:Oxysterol_BP 401 765 1.4e-72 PFAM
Meta Mutation Damage Score 0.2659 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (85/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Like most members, the encoded protein contains an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik A G 2: 85,485,527 Y440H probably damaging Het
Acoxl A T 2: 128,010,083 M102L probably benign Het
Adcy10 A G 1: 165,518,246 E288G probably damaging Het
Agap1 A G 1: 89,888,722 H748R probably benign Het
Ahsg T C 16: 22,892,257 L48P probably damaging Het
Ankrd27 A G 7: 35,612,526 T394A probably benign Het
Apc T G 18: 34,312,076 V657G probably damaging Het
Arl2 T C 19: 6,141,089 T5A probably benign Het
B020011L13Rik A G 1: 117,801,450 Y229C probably benign Het
B3gnt5 T A 16: 19,769,990 S320T probably damaging Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
BC107364 T G 3: 96,440,741 R77S unknown Het
Brox G A 1: 183,284,186 P206L possibly damaging Het
Ccrl2 T C 9: 111,055,885 K182E probably benign Het
Cd19 A G 7: 126,410,499 V465A possibly damaging Het
Chrdl2 A T 7: 100,022,033 Q126H probably damaging Het
Cnbd1 G A 4: 18,862,063 P376S probably benign Het
Cobll1 A G 2: 65,089,503 S1194P probably benign Het
Col6a4 T C 9: 106,067,014 Y1087C probably damaging Het
Col9a2 G A 4: 121,044,019 probably null Het
Cyp4v3 A G 8: 45,310,252 S341P possibly damaging Het
Dnah7a T A 1: 53,631,506 Y529F probably benign Het
Eif3b C T 5: 140,425,288 R165W probably damaging Het
Erlec1 C A 11: 30,950,790 C126F probably damaging Het
Fat2 T C 11: 55,269,433 T3285A probably benign Het
Fat2 G A 11: 55,281,851 R2679* probably null Het
Fbxo31 T C 8: 121,578,485 T91A probably damaging Het
Fkbp5 A G 17: 28,412,063 Y243H probably damaging Het
Flcn C T 11: 59,795,806 V374M probably damaging Het
Fndc5 A G 4: 129,139,523 M128V probably benign Het
Gal3st1 A G 11: 3,999,002 D403G probably damaging Het
Garem1 T C 18: 21,129,994 N588D probably benign Het
Gas1 T C 13: 60,176,233 T196A probably damaging Het
Gcn1l1 T C 5: 115,616,546 probably null Het
Gprc5d T G 6: 135,116,648 Q87P probably damaging Het
Grm1 A G 10: 10,719,595 L763P probably damaging Het
Hivep2 G T 10: 14,149,577 K2378N probably damaging Het
Hivep2 G T 10: 14,149,578 D2379Y probably damaging Het
Itgad A G 7: 128,182,989 Y199C probably damaging Het
Itm2c A G 1: 85,906,485 I174V probably benign Het
Khdrbs2 A G 1: 32,414,916 S128G probably benign Het
Map3k9 T C 12: 81,730,624 T528A probably benign Het
Mmp11 G A 10: 75,932,396 probably benign Het
Mycbpap T A 11: 94,514,614 I30F probably damaging Het
Nfya T C 17: 48,389,312 T335A probably benign Het
Npat T A 9: 53,569,916 S1008T possibly damaging Het
Olfr1145 A G 2: 87,810,716 T299A possibly damaging Het
Olfr121 G A 17: 37,752,409 C185Y probably damaging Het
Olfr494 A T 7: 108,368,350 M287L probably damaging Het
Olfr818 C T 10: 129,945,172 A297T possibly damaging Het
Pcdhga8 T C 18: 37,727,111 W407R probably benign Het
Pcdhgb4 A G 18: 37,721,362 D270G probably damaging Het
Pde2a A C 7: 101,511,597 E918D probably damaging Het
Plekhg5 A G 4: 152,113,974 D873G probably benign Het
Pno1 A T 11: 17,208,880 S173T possibly damaging Het
Ppfia3 A G 7: 45,354,736 I494T possibly damaging Het
Prkrip1 C A 5: 136,181,413 probably benign Het
Psma5 A G 3: 108,265,168 I67V probably benign Het
Reep6 G A 10: 80,333,965 probably null Het
Rtl1 CTCTTCTTCTTCACCATCTTCCTCCTCCTCCCCTTCTTCTTCTTCACCATCTTCCTCCTCCTCCCCTTCTTCTTCTTCACCATCTTCCTCCTCCTC CTCTTCTTCTTCACCATCTTCCTCCTCCTCCCCTTCTTCTTCTTCACCATCTTCCTCCTCCTC 12: 109,591,414 probably benign Het
Scyl2 C G 10: 89,645,461 probably null Het
Sdk1 T A 5: 142,096,726 probably null Het
Senp5 C A 16: 31,989,295 K380N probably benign Het
Slc22a14 A T 9: 119,231,215 probably null Het
Slc26a5 T A 5: 21,816,974 T485S possibly damaging Het
Slc44a5 T C 3: 154,253,719 I349T probably benign Het
Smarca5 T C 8: 80,736,726 E71G probably benign Het
Smok2a A T 17: 13,225,779 H81L probably damaging Het
Snrnp200 A G 2: 127,217,272 D388G probably benign Het
Tank T C 2: 61,653,422 V404A probably benign Het
Tek A G 4: 94,865,510 D1063G probably damaging Het
Tfap2a C T 13: 40,733,674 C16Y probably benign Het
Tmc1 A G 19: 20,940,903 probably null Het
Tnc A G 4: 63,984,589 F1484L probably benign Het
Tnfsf13 T A 11: 69,685,132 probably null Het
Tnrc6c T A 11: 117,733,618 S919T probably damaging Het
Trim17 C A 11: 58,968,616 Q219K probably benign Het
Trim5 T A 7: 104,265,668 H389L probably benign Het
Trio T A 15: 27,805,654 M583L possibly damaging Het
Ttll10 A T 4: 156,035,801 H389Q possibly damaging Het
Usp24 T C 4: 106,362,244 S546P probably benign Het
Vmn1r19 T A 6: 57,404,490 Y9* probably null Het
Vmn2r50 T A 7: 10,047,612 D402V probably damaging Het
Vmn2r93 C A 17: 18,313,286 A484E probably benign Het
Vps13a T C 19: 16,664,664 T2200A probably benign Het
Wdr36 T A 18: 32,841,905 H103Q probably benign Het
Zfp534 G A 4: 147,675,210 T334I possibly damaging Het
Zfp804b C T 5: 6,770,372 S897N probably benign Het
Other mutations in Osbpl10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Osbpl10 APN 9 115176002 missense probably benign 0.01
IGL01318:Osbpl10 APN 9 115232122 nonsense probably null
IGL02023:Osbpl10 APN 9 115226722 missense probably damaging 1.00
IGL02096:Osbpl10 APN 9 115216994 missense possibly damaging 0.94
R0534:Osbpl10 UTSW 9 115167178 missense probably damaging 1.00
R0948:Osbpl10 UTSW 9 115167119 missense probably damaging 1.00
R1073:Osbpl10 UTSW 9 115207553 nonsense probably null
R2138:Osbpl10 UTSW 9 115232134 missense probably benign 0.06
R3709:Osbpl10 UTSW 9 115207587 missense probably benign 0.11
R3710:Osbpl10 UTSW 9 115207587 missense probably benign 0.11
R4406:Osbpl10 UTSW 9 115109481 missense probably damaging 0.96
R4738:Osbpl10 UTSW 9 115216574 missense probably damaging 1.00
R4778:Osbpl10 UTSW 9 115109530 missense probably damaging 1.00
R4779:Osbpl10 UTSW 9 115109530 missense probably damaging 1.00
R5828:Osbpl10 UTSW 9 115061876 missense probably damaging 0.97
R5874:Osbpl10 UTSW 9 115226760 missense probably damaging 1.00
R6052:Osbpl10 UTSW 9 115067315 unclassified probably null
R6103:Osbpl10 UTSW 9 115061872 nonsense probably null
R6174:Osbpl10 UTSW 9 115109487 missense probably benign 0.00
R6246:Osbpl10 UTSW 9 115226774 missense probably benign 0.34
R7008:Osbpl10 UTSW 9 115061848 missense probably damaging 1.00
R7182:Osbpl10 UTSW 9 115067251 missense probably damaging 1.00
R7285:Osbpl10 UTSW 9 115223703 missense probably damaging 1.00
R7556:Osbpl10 UTSW 9 115207624 missense probably damaging 1.00
R7810:Osbpl10 UTSW 9 115061894 missense probably benign 0.01
R7853:Osbpl10 UTSW 9 115207658 missense probably damaging 1.00
R7905:Osbpl10 UTSW 9 115062010 critical splice donor site probably null
R7936:Osbpl10 UTSW 9 115207658 missense probably damaging 1.00
R7988:Osbpl10 UTSW 9 115062010 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACTCATGCTCTGCCCATTCATG -3'
(R):5'- GTCAGGCAAACACTATGCAG -3'

Sequencing Primer
(F):5'- ATGCTCTGCCCACTCATG -3'
(R):5'- TGTTTGAGACAAGACCCCATGTC -3'
Posted On2019-05-13