Incidental Mutation 'R7027:Tnrc6c'
ID546071
Institutional Source Beutler Lab
Gene Symbol Tnrc6c
Ensembl Gene ENSMUSG00000025571
Gene Nametrinucleotide repeat containing 6C
Synonyms9930033H14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7027 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location117654289-117763439 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 117733618 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 919 (S919T)
Ref Sequence ENSEMBL: ENSMUSP00000115221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026658] [ENSMUST00000106344] [ENSMUST00000138299]
Predicted Effect probably damaging
Transcript: ENSMUST00000026658
AA Change: S1079T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000026658
Gene: ENSMUSG00000025571
AA Change: S1079T

DomainStartEndE-ValueType
coiled coil region 1 32 N/A INTRINSIC
low complexity region 37 58 N/A INTRINSIC
low complexity region 110 132 N/A INTRINSIC
low complexity region 248 257 N/A INTRINSIC
low complexity region 298 318 N/A INTRINSIC
low complexity region 394 408 N/A INTRINSIC
low complexity region 440 457 N/A INTRINSIC
internal_repeat_1 472 573 2.14e-5 PROSPERO
low complexity region 594 614 N/A INTRINSIC
low complexity region 621 632 N/A INTRINSIC
internal_repeat_2 639 704 5.49e-5 PROSPERO
internal_repeat_1 799 902 2.14e-5 PROSPERO
low complexity region 964 981 N/A INTRINSIC
internal_repeat_2 991 1051 5.49e-5 PROSPERO
low complexity region 1063 1079 N/A INTRINSIC
low complexity region 1111 1125 N/A INTRINSIC
UBA 1145 1182 3.68e-4 SMART
Pfam:M_domain 1232 1459 6.8e-77 PFAM
Pfam:TNRC6-PABC_bdg 1468 1646 4.1e-75 PFAM
Pfam:TNRC6-PABC_bdg 1643 1722 3.7e-33 PFAM
RRM 1725 1792 1.81e-2 SMART
low complexity region 1813 1823 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106344
AA Change: S1079T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101951
Gene: ENSMUSG00000025571
AA Change: S1079T

DomainStartEndE-ValueType
coiled coil region 1 32 N/A INTRINSIC
low complexity region 37 58 N/A INTRINSIC
low complexity region 110 132 N/A INTRINSIC
low complexity region 248 257 N/A INTRINSIC
low complexity region 298 318 N/A INTRINSIC
low complexity region 394 408 N/A INTRINSIC
low complexity region 440 457 N/A INTRINSIC
internal_repeat_1 472 573 2.14e-5 PROSPERO
low complexity region 594 614 N/A INTRINSIC
low complexity region 621 632 N/A INTRINSIC
internal_repeat_2 639 704 5.49e-5 PROSPERO
internal_repeat_1 799 902 2.14e-5 PROSPERO
low complexity region 964 981 N/A INTRINSIC
internal_repeat_2 991 1051 5.49e-5 PROSPERO
low complexity region 1063 1079 N/A INTRINSIC
low complexity region 1111 1125 N/A INTRINSIC
UBA 1145 1182 3.68e-4 SMART
Pfam:M_domain 1232 1459 6.8e-77 PFAM
Pfam:TNRC6-PABC_bdg 1468 1646 4.1e-75 PFAM
Pfam:TNRC6-PABC_bdg 1643 1722 3.7e-33 PFAM
RRM 1725 1792 1.81e-2 SMART
low complexity region 1813 1823 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000138299
AA Change: S919T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000115221
Gene: ENSMUSG00000025571
AA Change: S919T

DomainStartEndE-ValueType
low complexity region 88 97 N/A INTRINSIC
low complexity region 138 158 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
low complexity region 280 297 N/A INTRINSIC
internal_repeat_1 312 413 9.45e-5 PROSPERO
low complexity region 434 454 N/A INTRINSIC
low complexity region 461 472 N/A INTRINSIC
internal_repeat_1 639 742 9.45e-5 PROSPERO
low complexity region 804 821 N/A INTRINSIC
low complexity region 903 919 N/A INTRINSIC
low complexity region 951 965 N/A INTRINSIC
UBA 985 1022 3.68e-4 SMART
Pfam:M_domain 1036 1293 1.7e-53 PFAM
low complexity region 1397 1406 N/A INTRINSIC
PDB:3KTP|B 1422 1443 7e-7 PDB
low complexity region 1507 1518 N/A INTRINSIC
low complexity region 1531 1552 N/A INTRINSIC
RRM 1557 1624 1.81e-2 SMART
low complexity region 1645 1655 N/A INTRINSIC
Meta Mutation Damage Score 0.2560 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (85/87)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit complete neonatal lethality with cyanosis, respiratory distress and thickened mesenchyme in air sacs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik A G 2: 85,485,527 Y440H probably damaging Het
Acoxl A T 2: 128,010,083 M102L probably benign Het
Adcy10 A G 1: 165,518,246 E288G probably damaging Het
Agap1 A G 1: 89,888,722 H748R probably benign Het
Ahsg T C 16: 22,892,257 L48P probably damaging Het
Ankrd27 A G 7: 35,612,526 T394A probably benign Het
Apc T G 18: 34,312,076 V657G probably damaging Het
Arl2 T C 19: 6,141,089 T5A probably benign Het
B020011L13Rik A G 1: 117,801,450 Y229C probably benign Het
B3gnt5 T A 16: 19,769,990 S320T probably damaging Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
BC107364 T G 3: 96,440,741 R77S unknown Het
Brox G A 1: 183,284,186 P206L possibly damaging Het
Ccrl2 T C 9: 111,055,885 K182E probably benign Het
Cd19 A G 7: 126,410,499 V465A possibly damaging Het
Chrdl2 A T 7: 100,022,033 Q126H probably damaging Het
Cnbd1 G A 4: 18,862,063 P376S probably benign Het
Cobll1 A G 2: 65,089,503 S1194P probably benign Het
Col6a4 T C 9: 106,067,014 Y1087C probably damaging Het
Col9a2 G A 4: 121,044,019 probably null Het
Cyp4v3 A G 8: 45,310,252 S341P possibly damaging Het
Dnah7a T A 1: 53,631,506 Y529F probably benign Het
Eif3b C T 5: 140,425,288 R165W probably damaging Het
Erlec1 C A 11: 30,950,790 C126F probably damaging Het
Fat2 T C 11: 55,269,433 T3285A probably benign Het
Fat2 G A 11: 55,281,851 R2679* probably null Het
Fbxo31 T C 8: 121,578,485 T91A probably damaging Het
Fkbp5 A G 17: 28,412,063 Y243H probably damaging Het
Flcn C T 11: 59,795,806 V374M probably damaging Het
Fndc5 A G 4: 129,139,523 M128V probably benign Het
Gal3st1 A G 11: 3,999,002 D403G probably damaging Het
Garem1 T C 18: 21,129,994 N588D probably benign Het
Gas1 T C 13: 60,176,233 T196A probably damaging Het
Gcn1l1 T C 5: 115,616,546 probably null Het
Gprc5d T G 6: 135,116,648 Q87P probably damaging Het
Grm1 A G 10: 10,719,595 L763P probably damaging Het
Hivep2 G T 10: 14,149,577 K2378N probably damaging Het
Hivep2 G T 10: 14,149,578 D2379Y probably damaging Het
Itgad A G 7: 128,182,989 Y199C probably damaging Het
Itm2c A G 1: 85,906,485 I174V probably benign Het
Khdrbs2 A G 1: 32,414,916 S128G probably benign Het
Map3k9 T C 12: 81,730,624 T528A probably benign Het
Mmp11 G A 10: 75,932,396 probably benign Het
Mycbpap T A 11: 94,514,614 I30F probably damaging Het
Nfya T C 17: 48,389,312 T335A probably benign Het
Npat T A 9: 53,569,916 S1008T possibly damaging Het
Olfr1145 A G 2: 87,810,716 T299A possibly damaging Het
Olfr121 G A 17: 37,752,409 C185Y probably damaging Het
Olfr494 A T 7: 108,368,350 M287L probably damaging Het
Olfr818 C T 10: 129,945,172 A297T possibly damaging Het
Osbpl10 T C 9: 115,223,698 V613A probably damaging Het
Pcdhga8 T C 18: 37,727,111 W407R probably benign Het
Pcdhgb4 A G 18: 37,721,362 D270G probably damaging Het
Pde2a A C 7: 101,511,597 E918D probably damaging Het
Plekhg5 A G 4: 152,113,974 D873G probably benign Het
Pno1 A T 11: 17,208,880 S173T possibly damaging Het
Ppfia3 A G 7: 45,354,736 I494T possibly damaging Het
Prkrip1 C A 5: 136,181,413 probably benign Het
Psma5 A G 3: 108,265,168 I67V probably benign Het
Reep6 G A 10: 80,333,965 probably null Het
Rtl1 CTCTTCTTCTTCACCATCTTCCTCCTCCTCCCCTTCTTCTTCTTCACCATCTTCCTCCTCCTCCCCTTCTTCTTCTTCACCATCTTCCTCCTCCTC CTCTTCTTCTTCACCATCTTCCTCCTCCTCCCCTTCTTCTTCTTCACCATCTTCCTCCTCCTC 12: 109,591,414 probably benign Het
Scyl2 C G 10: 89,645,461 probably null Het
Sdk1 T A 5: 142,096,726 probably null Het
Senp5 C A 16: 31,989,295 K380N probably benign Het
Slc22a14 A T 9: 119,231,215 probably null Het
Slc26a5 T A 5: 21,816,974 T485S possibly damaging Het
Slc44a5 T C 3: 154,253,719 I349T probably benign Het
Smarca5 T C 8: 80,736,726 E71G probably benign Het
Smok2a A T 17: 13,225,779 H81L probably damaging Het
Snrnp200 A G 2: 127,217,272 D388G probably benign Het
Tank T C 2: 61,653,422 V404A probably benign Het
Tek A G 4: 94,865,510 D1063G probably damaging Het
Tfap2a C T 13: 40,733,674 C16Y probably benign Het
Tmc1 A G 19: 20,940,903 probably null Het
Tnc A G 4: 63,984,589 F1484L probably benign Het
Tnfsf13 T A 11: 69,685,132 probably null Het
Trim17 C A 11: 58,968,616 Q219K probably benign Het
Trim5 T A 7: 104,265,668 H389L probably benign Het
Trio T A 15: 27,805,654 M583L possibly damaging Het
Ttll10 A T 4: 156,035,801 H389Q possibly damaging Het
Usp24 T C 4: 106,362,244 S546P probably benign Het
Vmn1r19 T A 6: 57,404,490 Y9* probably null Het
Vmn2r50 T A 7: 10,047,612 D402V probably damaging Het
Vmn2r93 C A 17: 18,313,286 A484E probably benign Het
Vps13a T C 19: 16,664,664 T2200A probably benign Het
Wdr36 T A 18: 32,841,905 H103Q probably benign Het
Zfp534 G A 4: 147,675,210 T334I possibly damaging Het
Zfp804b C T 5: 6,770,372 S897N probably benign Het
Other mutations in Tnrc6c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Tnrc6c APN 11 117714185 missense possibly damaging 0.91
IGL01013:Tnrc6c APN 11 117722029 missense probably benign 0.44
IGL01092:Tnrc6c APN 11 117721985 missense probably damaging 0.99
IGL01383:Tnrc6c APN 11 117714257 missense probably benign 0.37
IGL01395:Tnrc6c APN 11 117723113 missense probably benign 0.08
IGL01726:Tnrc6c APN 11 117749335 splice site probably benign
IGL01869:Tnrc6c APN 11 117755448 missense possibly damaging 0.65
IGL02108:Tnrc6c APN 11 117721199 missense probably benign 0.29
IGL02457:Tnrc6c APN 11 117722977 missense probably benign 0.28
IGL02612:Tnrc6c APN 11 117743000 missense possibly damaging 0.95
IGL02748:Tnrc6c APN 11 117732170 missense probably benign 0.00
IGL03160:Tnrc6c APN 11 117749825 splice site probably benign
rodion UTSW 11 117738350 critical splice donor site probably null
F5770:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
K3955:Tnrc6c UTSW 11 117760738 missense probably damaging 0.99
R0015:Tnrc6c UTSW 11 117721458 missense probably damaging 0.98
R0143:Tnrc6c UTSW 11 117752985 missense probably damaging 1.00
R0277:Tnrc6c UTSW 11 117739881 missense probably damaging 1.00
R0323:Tnrc6c UTSW 11 117739881 missense probably damaging 1.00
R0464:Tnrc6c UTSW 11 117760549 missense probably damaging 1.00
R0699:Tnrc6c UTSW 11 117722621 missense probably benign 0.02
R1015:Tnrc6c UTSW 11 117721922 missense possibly damaging 0.89
R1201:Tnrc6c UTSW 11 117721674 missense probably damaging 0.96
R1297:Tnrc6c UTSW 11 117733703 missense possibly damaging 0.52
R1560:Tnrc6c UTSW 11 117759637 missense probably damaging 1.00
R1596:Tnrc6c UTSW 11 117758041 missense probably damaging 1.00
R1758:Tnrc6c UTSW 11 117760730 missense probably benign 0.09
R1892:Tnrc6c UTSW 11 117714362 missense probably benign
R1901:Tnrc6c UTSW 11 117723005 missense probably damaging 0.98
R1935:Tnrc6c UTSW 11 117756023 missense possibly damaging 0.91
R1936:Tnrc6c UTSW 11 117756023 missense possibly damaging 0.91
R1937:Tnrc6c UTSW 11 117756023 missense possibly damaging 0.91
R1940:Tnrc6c UTSW 11 117756023 missense possibly damaging 0.91
R3622:Tnrc6c UTSW 11 117749625 missense probably damaging 1.00
R3711:Tnrc6c UTSW 11 117723124 missense probably benign 0.00
R3725:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3775:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3776:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3836:Tnrc6c UTSW 11 117723229 missense probably benign 0.20
R3844:Tnrc6c UTSW 11 117755483 missense probably damaging 1.00
R3852:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3928:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3929:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3937:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3943:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R4501:Tnrc6c UTSW 11 117722498 missense probably damaging 1.00
R4510:Tnrc6c UTSW 11 117742958 missense possibly damaging 0.68
R4511:Tnrc6c UTSW 11 117742958 missense possibly damaging 0.68
R4654:Tnrc6c UTSW 11 117720971 missense probably benign
R4765:Tnrc6c UTSW 11 117742927 missense probably benign 0.09
R4824:Tnrc6c UTSW 11 117722905 missense probably damaging 0.98
R5004:Tnrc6c UTSW 11 117721046 missense probably benign 0.44
R5094:Tnrc6c UTSW 11 117721046 missense probably benign 0.00
R5130:Tnrc6c UTSW 11 117738350 critical splice donor site probably null
R5234:Tnrc6c UTSW 11 117760729 missense probably benign 0.42
R5235:Tnrc6c UTSW 11 117760729 missense probably benign 0.42
R5345:Tnrc6c UTSW 11 117723287 missense possibly damaging 0.80
R5359:Tnrc6c UTSW 11 117758905 splice site silent
R5428:Tnrc6c UTSW 11 117700762 start codon destroyed probably null
R5548:Tnrc6c UTSW 11 117760843 missense possibly damaging 0.96
R5587:Tnrc6c UTSW 11 117749271 nonsense probably null
R5875:Tnrc6c UTSW 11 117759708 missense probably damaging 0.99
R5947:Tnrc6c UTSW 11 117722519 missense probably damaging 1.00
R6135:Tnrc6c UTSW 11 117736005 missense probably damaging 0.97
R6354:Tnrc6c UTSW 11 117749614 missense possibly damaging 0.90
R6389:Tnrc6c UTSW 11 117722741 missense probably damaging 0.99
R7048:Tnrc6c UTSW 11 117721974 missense probably benign 0.41
R7098:Tnrc6c UTSW 11 117714126 missense probably benign 0.03
R7315:Tnrc6c UTSW 11 117723528 missense probably benign 0.11
R7378:Tnrc6c UTSW 11 117741780 missense probably benign 0.03
R7386:Tnrc6c UTSW 11 117721954 missense probably benign
R7515:Tnrc6c UTSW 11 117741681 missense probably benign 0.03
R7665:Tnrc6c UTSW 11 117720951 missense possibly damaging 0.46
R7755:Tnrc6c UTSW 11 117758086 missense probably benign 0.00
V7580:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
V7581:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
V7582:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
V7583:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
Z1176:Tnrc6c UTSW 11 117732177
Predicted Primers PCR Primer
(F):5'- GGTTCAGTACAGCTGGAGTTAC -3'
(R):5'- TTCCCAGCCATGACTAGACC -3'

Sequencing Primer
(F):5'- TTCAGTACAGCTGGAGTTACAAAGG -3'
(R):5'- ATGACTAGACCTGCCTCGC -3'
Posted On2019-05-13