Incidental Mutation 'R7027:Bach1'
ID546080
Institutional Source Beutler Lab
Gene Symbol Bach1
Ensembl Gene ENSMUSG00000025612
Gene NameBTB and CNC homology 1, basic leucine zipper transcription factor 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7027 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location87698945-87733346 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 87719291 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 240 (R240Q)
Ref Sequence ENSEMBL: ENSMUSP00000026703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026703]
PDB Structure Structure of mouse Bach1 BTB domain [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000026703
AA Change: R240Q

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000026703
Gene: ENSMUSG00000025612
AA Change: R240Q

DomainStartEndE-ValueType
BTB 34 130 1.23e-24 SMART
Blast:BTB 153 235 2e-29 BLAST
low complexity region 378 390 N/A INTRINSIC
low complexity region 504 517 N/A INTRINSIC
BRLZ 556 622 1.2e-12 SMART
low complexity region 699 717 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (85/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that belongs to the cap'n'collar type of basic region leucine zipper factor family (CNC-bZip). The encoded protein contains broad complex, tramtrack, bric-a-brac/poxvirus and zinc finger (BTB/POZ) domains, which is atypical of CNC-bZip family members. These BTB/POZ domains facilitate protein-protein interactions and formation of homo- and/or hetero-oligomers. When this encoded protein forms a heterodimer with MafK, it functions as a repressor of Maf recognition element (MARE) and transcription is repressed. Multiple alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous null mice are healthy and fertile with no gross abnormalities but express elevated levels of HMOX1. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik A G 2: 85,485,527 Y440H probably damaging Het
Acoxl A T 2: 128,010,083 M102L probably benign Het
Adcy10 A G 1: 165,518,246 E288G probably damaging Het
Agap1 A G 1: 89,888,722 H748R probably benign Het
Ahsg T C 16: 22,892,257 L48P probably damaging Het
Ankrd27 A G 7: 35,612,526 T394A probably benign Het
Apc T G 18: 34,312,076 V657G probably damaging Het
Arl2 T C 19: 6,141,089 T5A probably benign Het
B020011L13Rik A G 1: 117,801,450 Y229C probably benign Het
B3gnt5 T A 16: 19,769,990 S320T probably damaging Het
BC107364 T G 3: 96,440,741 R77S unknown Het
Brox G A 1: 183,284,186 P206L possibly damaging Het
Ccrl2 T C 9: 111,055,885 K182E probably benign Het
Cd19 A G 7: 126,410,499 V465A possibly damaging Het
Chrdl2 A T 7: 100,022,033 Q126H probably damaging Het
Cnbd1 G A 4: 18,862,063 P376S probably benign Het
Cobll1 A G 2: 65,089,503 S1194P probably benign Het
Col6a4 T C 9: 106,067,014 Y1087C probably damaging Het
Col9a2 G A 4: 121,044,019 probably null Het
Cyp4v3 A G 8: 45,310,252 S341P possibly damaging Het
Dnah7a T A 1: 53,631,506 Y529F probably benign Het
Eif3b C T 5: 140,425,288 R165W probably damaging Het
Erlec1 C A 11: 30,950,790 C126F probably damaging Het
Fat2 G A 11: 55,281,851 R2679* probably null Het
Fat2 T C 11: 55,269,433 T3285A probably benign Het
Fbxo31 T C 8: 121,578,485 T91A probably damaging Het
Fkbp5 A G 17: 28,412,063 Y243H probably damaging Het
Flcn C T 11: 59,795,806 V374M probably damaging Het
Fndc5 A G 4: 129,139,523 M128V probably benign Het
Gal3st1 A G 11: 3,999,002 D403G probably damaging Het
Garem1 T C 18: 21,129,994 N588D probably benign Het
Gas1 T C 13: 60,176,233 T196A probably damaging Het
Gcn1l1 T C 5: 115,616,546 probably null Het
Gprc5d T G 6: 135,116,648 Q87P probably damaging Het
Grm1 A G 10: 10,719,595 L763P probably damaging Het
Hivep2 G T 10: 14,149,577 K2378N probably damaging Het
Hivep2 G T 10: 14,149,578 D2379Y probably damaging Het
Itgad A G 7: 128,182,989 Y199C probably damaging Het
Itm2c A G 1: 85,906,485 I174V probably benign Het
Khdrbs2 A G 1: 32,414,916 S128G probably benign Het
Map3k9 T C 12: 81,730,624 T528A probably benign Het
Mmp11 G A 10: 75,932,396 probably benign Het
Mycbpap T A 11: 94,514,614 I30F probably damaging Het
Nfya T C 17: 48,389,312 T335A probably benign Het
Npat T A 9: 53,569,916 S1008T possibly damaging Het
Olfr1145 A G 2: 87,810,716 T299A possibly damaging Het
Olfr121 G A 17: 37,752,409 C185Y probably damaging Het
Olfr494 A T 7: 108,368,350 M287L probably damaging Het
Olfr818 C T 10: 129,945,172 A297T possibly damaging Het
Osbpl10 T C 9: 115,223,698 V613A probably damaging Het
Pcdhga8 T C 18: 37,727,111 W407R probably benign Het
Pcdhgb4 A G 18: 37,721,362 D270G probably damaging Het
Pde2a A C 7: 101,511,597 E918D probably damaging Het
Plekhg5 A G 4: 152,113,974 D873G probably benign Het
Pno1 A T 11: 17,208,880 S173T possibly damaging Het
Ppfia3 A G 7: 45,354,736 I494T possibly damaging Het
Prkrip1 C A 5: 136,181,413 probably benign Het
Psma5 A G 3: 108,265,168 I67V probably benign Het
Reep6 G A 10: 80,333,965 probably null Het
Rtl1 CTCTTCTTCTTCACCATCTTCCTCCTCCTCCCCTTCTTCTTCTTCACCATCTTCCTCCTCCTCCCCTTCTTCTTCTTCACCATCTTCCTCCTCCTC CTCTTCTTCTTCACCATCTTCCTCCTCCTCCCCTTCTTCTTCTTCACCATCTTCCTCCTCCTC 12: 109,591,414 probably benign Het
Scyl2 C G 10: 89,645,461 probably null Het
Sdk1 T A 5: 142,096,726 probably null Het
Senp5 C A 16: 31,989,295 K380N probably benign Het
Slc22a14 A T 9: 119,231,215 probably null Het
Slc26a5 T A 5: 21,816,974 T485S possibly damaging Het
Slc44a5 T C 3: 154,253,719 I349T probably benign Het
Smarca5 T C 8: 80,736,726 E71G probably benign Het
Smok2a A T 17: 13,225,779 H81L probably damaging Het
Snrnp200 A G 2: 127,217,272 D388G probably benign Het
Tank T C 2: 61,653,422 V404A probably benign Het
Tek A G 4: 94,865,510 D1063G probably damaging Het
Tfap2a C T 13: 40,733,674 C16Y probably benign Het
Tmc1 A G 19: 20,940,903 probably null Het
Tnc A G 4: 63,984,589 F1484L probably benign Het
Tnfsf13 T A 11: 69,685,132 probably null Het
Tnrc6c T A 11: 117,733,618 S919T probably damaging Het
Trim17 C A 11: 58,968,616 Q219K probably benign Het
Trim5 T A 7: 104,265,668 H389L probably benign Het
Trio T A 15: 27,805,654 M583L possibly damaging Het
Ttll10 A T 4: 156,035,801 H389Q possibly damaging Het
Usp24 T C 4: 106,362,244 S546P probably benign Het
Vmn1r19 T A 6: 57,404,490 Y9* probably null Het
Vmn2r50 T A 7: 10,047,612 D402V probably damaging Het
Vmn2r93 C A 17: 18,313,286 A484E probably benign Het
Vps13a T C 19: 16,664,664 T2200A probably benign Het
Wdr36 T A 18: 32,841,905 H103Q probably benign Het
Zfp534 G A 4: 147,675,210 T334I possibly damaging Het
Zfp804b C T 5: 6,770,372 S897N probably benign Het
Other mutations in Bach1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01553:Bach1 APN 16 87722505 missense probably damaging 1.00
R0626:Bach1 UTSW 16 87729471 missense possibly damaging 0.94
R0701:Bach1 UTSW 16 87719989 missense probably damaging 0.99
R1070:Bach1 UTSW 16 87720121 missense probably benign 0.02
R1160:Bach1 UTSW 16 87715434 missense probably benign 0.34
R2066:Bach1 UTSW 16 87729625 missense probably damaging 0.99
R2235:Bach1 UTSW 16 87720113 missense probably damaging 1.00
R4716:Bach1 UTSW 16 87715379 start gained probably benign
R4801:Bach1 UTSW 16 87722452 missense probably damaging 0.99
R4802:Bach1 UTSW 16 87722452 missense probably damaging 0.99
R4989:Bach1 UTSW 16 87719000 missense possibly damaging 0.94
R5016:Bach1 UTSW 16 87719318 missense possibly damaging 0.88
R5527:Bach1 UTSW 16 87719545 missense probably benign 0.01
R5657:Bach1 UTSW 16 87719285 missense probably benign 0.00
R6064:Bach1 UTSW 16 87729864 missense probably damaging 1.00
R6384:Bach1 UTSW 16 87719857 nonsense probably null
R7009:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7028:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7029:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7030:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7095:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7096:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7192:Bach1 UTSW 16 87729663 missense possibly damaging 0.71
R7385:Bach1 UTSW 16 87729497 missense probably damaging 0.99
R7571:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7572:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7623:Bach1 UTSW 16 87719291 missense probably benign 0.10
R7632:Bach1 UTSW 16 87720143 missense probably benign 0.00
R7714:Bach1 UTSW 16 87718848 nonsense probably null
R7715:Bach1 UTSW 16 87719971 missense possibly damaging 0.82
R7746:Bach1 UTSW 16 87729633 missense probably benign 0.00
R7896:Bach1 UTSW 16 87719005 missense possibly damaging 0.63
R8129:Bach1 UTSW 16 87722426 missense possibly damaging 0.51
R8169:Bach1 UTSW 16 87722502 missense possibly damaging 0.93
R8296:Bach1 UTSW 16 87729579 missense probably damaging 1.00
R8300:Bach1 UTSW 16 87719108 missense probably benign
R8388:Bach1 UTSW 16 87719291 missense probably benign 0.10
R8389:Bach1 UTSW 16 87719291 missense probably benign 0.10
R8391:Bach1 UTSW 16 87719291 missense probably benign 0.10
R8480:Bach1 UTSW 16 87719275 missense probably damaging 1.00
R8691:Bach1 UTSW 16 87719629 missense probably benign
R8748:Bach1 UTSW 16 87719291 missense probably benign 0.10
R8749:Bach1 UTSW 16 87719291 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AAGAAACGTGTTCAGACGCC -3'
(R):5'- AATCCTGAGGCAAGGGTGTC -3'

Sequencing Primer
(F):5'- TGTTCAGACGCCTCAGTGTGAC -3'
(R):5'- CACTGAGGGGAGGGATCCTG -3'
Posted On2019-05-13