Incidental Mutation 'R7027:Apc'
ID546087
Institutional Source Beutler Lab
Gene Symbol Apc
Ensembl Gene ENSMUSG00000005871
Gene Nameadenomatosis polyposis coli
SynonymsCC1, Min
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_007462.3; MGI:88039

Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R7027 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location34220924-34322189 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 34312076 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 657 (V657G)
Ref Sequence ENSEMBL: ENSMUSP00000127131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079362] [ENSMUST00000115781] [ENSMUST00000171187]
Predicted Effect probably damaging
Transcript: ENSMUST00000079362
AA Change: V675G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078337
Gene: ENSMUSG00000005871
AA Change: V675G

DomainStartEndE-ValueType
Pfam:APC_N_CC 4 55 6e-32 PFAM
low complexity region 92 109 N/A INTRINSIC
Pfam:Suppressor_APC 125 205 2e-24 PFAM
low complexity region 211 222 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
ARM 338 390 6.14e-5 SMART
ARM 457 508 1.62e-4 SMART
ARM 510 551 8.56e-4 SMART
ARM 554 595 4.45e-2 SMART
ARM 597 642 5.76e1 SMART
ARM 647 687 1.29e-7 SMART
Pfam:Arm_APC_u3 730 1017 5e-170 PFAM
Pfam:APC_15aa 1018 1032 1.1e-8 PFAM
Pfam:APC_u5 1034 1133 7.6e-55 PFAM
Pfam:APC_15aa 1154 1168 1.6e-8 PFAM
Pfam:APC_15aa 1171 1185 1.9e-9 PFAM
low complexity region 1187 1204 N/A INTRINSIC
Pfam:APC_crr 1255 1279 1.5e-15 PFAM
Pfam:APC_u9 1280 1367 1.9e-34 PFAM
Pfam:APC_crr 1370 1393 2.2e-10 PFAM
low complexity region 1431 1449 N/A INTRINSIC
Pfam:APC_crr 1485 1509 2.1e-9 PFAM
low complexity region 1532 1548 N/A INTRINSIC
Pfam:SAMP 1568 1587 2.7e-11 PFAM
Pfam:APC_crr 1635 1659 1.9e-15 PFAM
Pfam:APC_u13 1660 1716 1.3e-31 PFAM
Pfam:SAMP 1717 1736 3.2e-12 PFAM
Pfam:APC_u14 1737 1837 1e-46 PFAM
Pfam:APC_crr 1839 1864 6.8e-15 PFAM
Pfam:APC_u15 1865 1945 1.8e-40 PFAM
Pfam:APC_crr 1947 1971 1.6e-14 PFAM
Pfam:APC_crr 2007 2030 1.8e-14 PFAM
Pfam:SAMP 2033 2052 1.6e-13 PFAM
low complexity region 2112 2146 N/A INTRINSIC
Pfam:APC_basic 2223 2579 1.5e-110 PFAM
low complexity region 2626 2638 N/A INTRINSIC
Pfam:EB1_binding 2670 2842 9.3e-89 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115781
AA Change: V641G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111447
Gene: ENSMUSG00000005871
AA Change: V641G

DomainStartEndE-ValueType
PDB:1DEB|B 2 55 1e-27 PDB
low complexity region 92 109 N/A INTRINSIC
Pfam:Suppressor_APC 124 206 1.5e-31 PFAM
low complexity region 211 222 N/A INTRINSIC
ARM 304 356 6.14e-5 SMART
ARM 423 474 1.62e-4 SMART
ARM 476 517 8.56e-4 SMART
ARM 520 561 4.45e-2 SMART
ARM 563 608 5.76e1 SMART
ARM 613 653 1.29e-7 SMART
Pfam:Arm 655 695 1.7e-6 PFAM
low complexity region 797 810 N/A INTRINSIC
low complexity region 880 892 N/A INTRINSIC
low complexity region 923 935 N/A INTRINSIC
Pfam:APC_15aa 984 999 3.7e-9 PFAM
Pfam:APC_15aa 1100 1115 8.4e-8 PFAM
Pfam:APC_15aa 1120 1135 9.9e-9 PFAM
Pfam:APC_15aa 1137 1152 1.2e-9 PFAM
low complexity region 1153 1170 N/A INTRINSIC
Pfam:APC_crr 1220 1245 7.5e-15 PFAM
low complexity region 1320 1331 N/A INTRINSIC
Pfam:APC_crr 1334 1359 2.8e-11 PFAM
low complexity region 1397 1415 N/A INTRINSIC
Pfam:APC_crr 1450 1475 2.2e-8 PFAM
low complexity region 1498 1514 N/A INTRINSIC
Pfam:SAMP 1533 1553 8.4e-12 PFAM
Pfam:APC_crr 1600 1625 3.5e-13 PFAM
Pfam:SAMP 1682 1702 5e-12 PFAM
low complexity region 1732 1744 N/A INTRINSIC
Pfam:APC_crr 1805 1830 3.1e-12 PFAM
low complexity region 1866 1877 N/A INTRINSIC
Pfam:APC_crr 1912 1937 3.5e-13 PFAM
Pfam:APC_crr 1971 1996 7.1e-14 PFAM
Pfam:SAMP 1999 2018 4.6e-13 PFAM
low complexity region 2078 2112 N/A INTRINSIC
Pfam:APC_basic 2189 2545 1.1e-131 PFAM
low complexity region 2592 2604 N/A INTRINSIC
Pfam:EB1_binding 2636 2808 2.9e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165590
SMART Domains Protein: ENSMUSP00000128327
Gene: ENSMUSG00000005871

DomainStartEndE-ValueType
PDB:3AU3|A 2 33 2e-17 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000171187
AA Change: V657G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127131
Gene: ENSMUSG00000005871
AA Change: V657G

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
low complexity region 23 52 N/A INTRINSIC
low complexity region 102 119 N/A INTRINSIC
Pfam:Suppressor_APC 134 216 5.2e-32 PFAM
ARM 320 372 6.14e-5 SMART
ARM 439 490 1.62e-4 SMART
ARM 492 533 8.56e-4 SMART
ARM 536 577 4.45e-2 SMART
ARM 579 624 5.76e1 SMART
ARM 629 669 1.29e-7 SMART
Pfam:Arm 671 711 6.3e-7 PFAM
low complexity region 813 826 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 939 951 N/A INTRINSIC
Pfam:APC_15aa 1000 1015 1.4e-9 PFAM
Pfam:APC_15aa 1116 1131 3.1e-8 PFAM
Meta Mutation Damage Score 0.6113 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (85/87)
MGI Phenotype Strain: 1856318; 2387050; 1857951; 1857957
Lethality: E8-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tumor suppressor protein that acts as an antagonist of the Wnt signaling pathway. It is also involved in other processes including cell migration and adhesion, transcriptional activation, and apoptosis. Defects in this gene cause familial adenomatous polyposis (FAP), an autosomal dominant pre-malignant disease that usually progresses to malignancy. Disease-associated mutations tend to be clustered in a small region designated the mutation cluster region (MCR) and result in a truncated protein product. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most targeted and hypomorphic heterozygous mutants develop intestinal polyps and colorectal cancer, associated with anemia from intestinal bleeding. Homozygotes are embryonic lethal. Homozygotes for a mild alleles survive and have less extreme tumor incidence. [provided by MGI curators]
Allele List at MGI

All alleles(88) : Targeted(25) Gene trapped(62) Chemically induced(1)

Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik A G 2: 85,485,527 Y440H probably damaging Het
Acoxl A T 2: 128,010,083 M102L probably benign Het
Adcy10 A G 1: 165,518,246 E288G probably damaging Het
Agap1 A G 1: 89,888,722 H748R probably benign Het
Ahsg T C 16: 22,892,257 L48P probably damaging Het
Ankrd27 A G 7: 35,612,526 T394A probably benign Het
Arl2 T C 19: 6,141,089 T5A probably benign Het
B020011L13Rik A G 1: 117,801,450 Y229C probably benign Het
B3gnt5 T A 16: 19,769,990 S320T probably damaging Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
BC107364 T G 3: 96,440,741 R77S unknown Het
Brox G A 1: 183,284,186 P206L possibly damaging Het
Ccrl2 T C 9: 111,055,885 K182E probably benign Het
Cd19 A G 7: 126,410,499 V465A possibly damaging Het
Chrdl2 A T 7: 100,022,033 Q126H probably damaging Het
Cnbd1 G A 4: 18,862,063 P376S probably benign Het
Cobll1 A G 2: 65,089,503 S1194P probably benign Het
Col6a4 T C 9: 106,067,014 Y1087C probably damaging Het
Col9a2 G A 4: 121,044,019 probably null Het
Cyp4v3 A G 8: 45,310,252 S341P possibly damaging Het
Dnah7a T A 1: 53,631,506 Y529F probably benign Het
Eif3b C T 5: 140,425,288 R165W probably damaging Het
Erlec1 C A 11: 30,950,790 C126F probably damaging Het
Fat2 T C 11: 55,269,433 T3285A probably benign Het
Fat2 G A 11: 55,281,851 R2679* probably null Het
Fbxo31 T C 8: 121,578,485 T91A probably damaging Het
Fkbp5 A G 17: 28,412,063 Y243H probably damaging Het
Flcn C T 11: 59,795,806 V374M probably damaging Het
Fndc5 A G 4: 129,139,523 M128V probably benign Het
Gal3st1 A G 11: 3,999,002 D403G probably damaging Het
Garem1 T C 18: 21,129,994 N588D probably benign Het
Gas1 T C 13: 60,176,233 T196A probably damaging Het
Gcn1l1 T C 5: 115,616,546 probably null Het
Gprc5d T G 6: 135,116,648 Q87P probably damaging Het
Grm1 A G 10: 10,719,595 L763P probably damaging Het
Hivep2 G T 10: 14,149,577 K2378N probably damaging Het
Hivep2 G T 10: 14,149,578 D2379Y probably damaging Het
Itgad A G 7: 128,182,989 Y199C probably damaging Het
Itm2c A G 1: 85,906,485 I174V probably benign Het
Khdrbs2 A G 1: 32,414,916 S128G probably benign Het
Map3k9 T C 12: 81,730,624 T528A probably benign Het
Mmp11 G A 10: 75,932,396 probably benign Het
Mycbpap T A 11: 94,514,614 I30F probably damaging Het
Nfya T C 17: 48,389,312 T335A probably benign Het
Npat T A 9: 53,569,916 S1008T possibly damaging Het
Olfr1145 A G 2: 87,810,716 T299A possibly damaging Het
Olfr121 G A 17: 37,752,409 C185Y probably damaging Het
Olfr494 A T 7: 108,368,350 M287L probably damaging Het
Olfr818 C T 10: 129,945,172 A297T possibly damaging Het
Osbpl10 T C 9: 115,223,698 V613A probably damaging Het
Pcdhga8 T C 18: 37,727,111 W407R probably benign Het
Pcdhgb4 A G 18: 37,721,362 D270G probably damaging Het
Pde2a A C 7: 101,511,597 E918D probably damaging Het
Plekhg5 A G 4: 152,113,974 D873G probably benign Het
Pno1 A T 11: 17,208,880 S173T possibly damaging Het
Ppfia3 A G 7: 45,354,736 I494T possibly damaging Het
Prkrip1 C A 5: 136,181,413 probably benign Het
Psma5 A G 3: 108,265,168 I67V probably benign Het
Reep6 G A 10: 80,333,965 probably null Het
Rtl1 CTCTTCTTCTTCACCATCTTCCTCCTCCTCCCCTTCTTCTTCTTCACCATCTTCCTCCTCCTCCCCTTCTTCTTCTTCACCATCTTCCTCCTCCTC CTCTTCTTCTTCACCATCTTCCTCCTCCTCCCCTTCTTCTTCTTCACCATCTTCCTCCTCCTC 12: 109,591,414 probably benign Het
Scyl2 C G 10: 89,645,461 probably null Het
Sdk1 T A 5: 142,096,726 probably null Het
Senp5 C A 16: 31,989,295 K380N probably benign Het
Slc22a14 A T 9: 119,231,215 probably null Het
Slc26a5 T A 5: 21,816,974 T485S possibly damaging Het
Slc44a5 T C 3: 154,253,719 I349T probably benign Het
Smarca5 T C 8: 80,736,726 E71G probably benign Het
Smok2a A T 17: 13,225,779 H81L probably damaging Het
Snrnp200 A G 2: 127,217,272 D388G probably benign Het
Tank T C 2: 61,653,422 V404A probably benign Het
Tek A G 4: 94,865,510 D1063G probably damaging Het
Tfap2a C T 13: 40,733,674 C16Y probably benign Het
Tmc1 A G 19: 20,940,903 probably null Het
Tnc A G 4: 63,984,589 F1484L probably benign Het
Tnfsf13 T A 11: 69,685,132 probably null Het
Tnrc6c T A 11: 117,733,618 S919T probably damaging Het
Trim17 C A 11: 58,968,616 Q219K probably benign Het
Trim5 T A 7: 104,265,668 H389L probably benign Het
Trio T A 15: 27,805,654 M583L possibly damaging Het
Ttll10 A T 4: 156,035,801 H389Q possibly damaging Het
Usp24 T C 4: 106,362,244 S546P probably benign Het
Vmn1r19 T A 6: 57,404,490 Y9* probably null Het
Vmn2r50 T A 7: 10,047,612 D402V probably damaging Het
Vmn2r93 C A 17: 18,313,286 A484E probably benign Het
Vps13a T C 19: 16,664,664 T2200A probably benign Het
Wdr36 T A 18: 32,841,905 H103Q probably benign Het
Zfp534 G A 4: 147,675,210 T334I possibly damaging Het
Zfp804b C T 5: 6,770,372 S897N probably benign Het
Other mutations in Apc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Apc APN 18 34316926 missense probably benign 0.01
IGL00898:Apc APN 18 34317094 missense probably damaging 1.00
IGL01111:Apc APN 18 34315136 missense possibly damaging 0.95
IGL01347:Apc APN 18 34317670 missense probably damaging 1.00
IGL01375:Apc APN 18 34313654 missense probably damaging 1.00
IGL01805:Apc APN 18 34318218 missense probably benign 0.02
IGL01997:Apc APN 18 34315423 missense probably benign 0.00
IGL02033:Apc APN 18 34310719 missense probably damaging 1.00
IGL02323:Apc APN 18 34315810 nonsense probably null
IGL02373:Apc APN 18 34316159 missense probably damaging 1.00
IGL02379:Apc APN 18 34298745 missense probably benign 0.45
IGL02456:Apc APN 18 34313882 nonsense probably null
IGL02552:Apc APN 18 34312982 missense possibly damaging 0.90
IGL02676:Apc APN 18 34315634 missense probably damaging 1.00
IGL02756:Apc APN 18 34314535 missense probably damaging 1.00
IGL02938:Apc APN 18 34315228 missense probably damaging 0.98
IGL02974:Apc APN 18 34268383 splice site probably benign
IGL03124:Apc APN 18 34299985 missense probably damaging 0.98
IGL03201:Apc APN 18 34312376 missense probably damaging 1.00
IGL03339:Apc APN 18 34298474 missense probably damaging 1.00
FR4304:Apc UTSW 18 34281997 intron probably benign
FR4342:Apc UTSW 18 34281999 intron probably benign
FR4449:Apc UTSW 18 34282000 intron probably benign
FR4449:Apc UTSW 18 34282005 intron probably benign
FR4548:Apc UTSW 18 34281998 intron probably benign
FR4737:Apc UTSW 18 34281999 intron probably benign
FR4976:Apc UTSW 18 34281998 intron probably benign
FR4976:Apc UTSW 18 34282000 intron probably benign
FR4976:Apc UTSW 18 34282004 nonsense probably null
R0385:Apc UTSW 18 34315944 missense probably damaging 1.00
R0535:Apc UTSW 18 34261072 missense probably damaging 1.00
R0561:Apc UTSW 18 34313303 missense possibly damaging 0.94
R0590:Apc UTSW 18 34316230 nonsense probably null
R0626:Apc UTSW 18 34318454 missense probably damaging 1.00
R0991:Apc UTSW 18 34316107 missense probably damaging 1.00
R1564:Apc UTSW 18 34315149 missense probably benign 0.00
R1663:Apc UTSW 18 34268325 missense probably damaging 0.98
R1737:Apc UTSW 18 34317022 missense probably damaging 1.00
R1739:Apc UTSW 18 34312318 missense probably damaging 1.00
R1835:Apc UTSW 18 34317077 missense probably damaging 1.00
R1887:Apc UTSW 18 34272468 missense probably damaging 1.00
R1957:Apc UTSW 18 34317335 missense probably damaging 1.00
R1974:Apc UTSW 18 34300004 missense possibly damaging 0.62
R2005:Apc UTSW 18 34310909 critical splice donor site probably null
R2013:Apc UTSW 18 34315591 missense probably damaging 0.98
R2014:Apc UTSW 18 34315591 missense probably damaging 0.98
R2015:Apc UTSW 18 34315591 missense probably damaging 0.98
R2017:Apc UTSW 18 34313602 missense probably benign 0.00
R2056:Apc UTSW 18 34316428 missense probably damaging 1.00
R2108:Apc UTSW 18 34269229 missense probably damaging 1.00
R2120:Apc UTSW 18 34276601 missense probably damaging 1.00
R2131:Apc UTSW 18 34312045 missense possibly damaging 0.51
R2133:Apc UTSW 18 34312045 missense possibly damaging 0.51
R2291:Apc UTSW 18 34312491 missense probably benign 0.45
R2332:Apc UTSW 18 34317059 missense possibly damaging 0.50
R2360:Apc UTSW 18 34261126 missense probably damaging 1.00
R2407:Apc UTSW 18 34314262 missense possibly damaging 0.77
R2507:Apc UTSW 18 34316537 missense possibly damaging 0.77
R2940:Apc UTSW 18 34276670 missense probably damaging 1.00
R3404:Apc UTSW 18 34313602 missense probably benign 0.00
R3411:Apc UTSW 18 34269259 splice site probably benign
R3778:Apc UTSW 18 34313081 missense probably damaging 1.00
R3826:Apc UTSW 18 34279335 missense possibly damaging 0.93
R4599:Apc UTSW 18 34317987 nonsense probably null
R4611:Apc UTSW 18 34318565 missense probably damaging 1.00
R4664:Apc UTSW 18 34298594 missense probably damaging 0.98
R4969:Apc UTSW 18 34312918 nonsense probably null
R5007:Apc UTSW 18 34312963 missense probably damaging 1.00
R5066:Apc UTSW 18 34316105 missense probably damaging 1.00
R5112:Apc UTSW 18 34316109 nonsense probably null
R5259:Apc UTSW 18 34314290 missense probably benign 0.29
R5440:Apc UTSW 18 34221160 unclassified probably benign
R5508:Apc UTSW 18 34298580 missense probably damaging 0.97
R5512:Apc UTSW 18 34310909 critical splice donor site probably benign
R5850:Apc UTSW 18 34318063 missense possibly damaging 0.94
R5951:Apc UTSW 18 34317146 missense possibly damaging 0.89
R5966:Apc UTSW 18 34221087 utr 5 prime probably benign
R6081:Apc UTSW 18 34290111 missense possibly damaging 0.93
R6116:Apc UTSW 18 34316455 missense probably damaging 1.00
R6351:Apc UTSW 18 34312212 missense probably damaging 1.00
R6354:Apc UTSW 18 34312528 missense probably benign 0.02
R6467:Apc UTSW 18 34269199 missense probably benign 0.22
R6974:Apc UTSW 18 34298427 missense possibly damaging 0.65
R7096:Apc UTSW 18 34315957 missense probably damaging 1.00
R7289:Apc UTSW 18 34315271 missense probably damaging 1.00
R7439:Apc UTSW 18 34312073 missense probably damaging 1.00
R7441:Apc UTSW 18 34312073 missense probably damaging 1.00
R7534:Apc UTSW 18 34316962 missense probably damaging 1.00
R7685:Apc UTSW 18 34314208 missense probably damaging 1.00
R7814:Apc UTSW 18 34272539 missense probably damaging 0.98
RF046:Apc UTSW 18 34282009 critical splice donor site probably benign
RF063:Apc UTSW 18 34282009 critical splice donor site probably benign
X0021:Apc UTSW 18 34312108 missense probably damaging 1.00
X0025:Apc UTSW 18 34312376 missense probably damaging 1.00
Z1088:Apc UTSW 18 34313167 nonsense probably null
Z1177:Apc UTSW 18 34314463 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GCTGATGTGCTCATAACGTGC -3'
(R):5'- GCCGGGAGACATGATATTGG -3'

Sequencing Primer
(F):5'- GTGCTCATAACGTGCTTTGTAATC -3'
(R):5'- CGGGAGACATGATATTGGCATCC -3'
Posted On2019-05-13