Incidental Mutation 'R7028:Akp3'
ID546093
Institutional Source Beutler Lab
Gene Symbol Akp3
Ensembl Gene ENSMUSG00000036500
Gene Namealkaline phosphatase 3, intestine, not Mn requiring
SynonymsAkp-3, IAP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R7028 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location87124973-87127912 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87126778 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 303 (M303V)
Ref Sequence ENSEMBL: ENSMUSP00000037497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044878]
Predicted Effect probably benign
Transcript: ENSMUST00000044878
AA Change: M303V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037497
Gene: ENSMUSG00000036500
AA Change: M303V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 33 45 N/A INTRINSIC
alkPPc 53 487 1.92e-249 SMART
low complexity region 503 524 N/A INTRINSIC
low complexity region 533 557 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] There are at least four distinct but related alkaline phosphatases: intestinal, placental, placental-like, and liver/bone/kidney (tissue non-specific). The intestinal alkaline phosphatase gene encodes a digestive brush-border enzyme. This enzyme is a component of the gut mucosal defense system and is thought to function in the detoxification of lipopolysaccharide, and in the prevention of bacterial translocation in the gut. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for disruption of this gene show no gross abnormalities in appearance, behavior or fertility. They do display accelerated lipid absorption on a high fat diet leading to elevated plasma triglycerides and increased weight gain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A G 2: 69,265,675 I804T probably benign Het
Abcb1b A T 5: 8,805,441 E25V probably damaging Het
Adamts9 G T 6: 92,909,793 Y355* probably null Het
Ankrd35 A T 3: 96,683,334 E312V possibly damaging Het
Arhgap40 T C 2: 158,531,374 probably null Het
Asxl1 T C 2: 153,400,107 L859P probably benign Het
Atat1 A G 17: 35,910,005 F11L probably benign Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Ccdc7a A T 8: 128,881,594 H943Q unknown Het
Cep135 A G 5: 76,616,848 T558A probably benign Het
Cfap99 A G 5: 34,301,519 E86G possibly damaging Het
Cfhr2 C T 1: 139,831,063 probably null Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Col17a1 G A 19: 47,652,183 P992L probably damaging Het
Col7a1 C T 9: 108,963,263 Q1294* probably null Het
Coq8b T A 7: 27,239,868 C148S probably damaging Het
Csmd2 A G 4: 128,277,228 N338S Het
Cspg5 T A 9: 110,246,891 S232T possibly damaging Het
Cyp2c67 A G 19: 39,639,897 V201A possibly damaging Het
Dlgap3 G A 4: 127,195,517 R302H possibly damaging Het
Dpy19l2 T C 9: 24,628,251 I469V probably benign Het
Fam135b T C 15: 71,471,563 D401G probably damaging Het
Gabbr1 G T 17: 37,064,737 G453* probably null Het
Gclc C A 9: 77,788,216 A440D probably damaging Het
Glyat T C 19: 12,650,359 I106T probably benign Het
Gm12185 T C 11: 48,908,244 N474S possibly damaging Het
Gm17079 T C 14: 51,693,037 H117R Het
Gm884 C T 11: 103,614,537 A26T probably benign Het
Ildr2 A G 1: 166,303,529 D318G probably damaging Het
Kcnd2 G A 6: 21,216,178 probably benign Het
Kif19a C T 11: 114,781,208 T207M probably damaging Het
Kif3a G T 11: 53,586,906 G401* probably null Het
Lactbl1 T A 4: 136,632,975 L155Q probably damaging Het
Lrp1b T A 2: 41,246,011 D1649V probably benign Het
Map2k1 A G 9: 64,193,823 V191A probably benign Het
Mdm4 A T 1: 133,003,809 C165S probably benign Het
Med27 G A 2: 29,509,434 W92* probably null Het
Muc20 A T 16: 32,794,246 S254T probably benign Het
Myh1 A G 11: 67,220,421 E1562G possibly damaging Het
Nlrp2 C G 7: 5,328,572 R275P possibly damaging Het
Notch2 T A 3: 98,102,387 N543K probably damaging Het
Nup214 T A 2: 32,034,156 S1566T probably benign Het
Nxnl1 T G 8: 71,562,793 E157A possibly damaging Het
Obscn A G 11: 59,079,133 L61P probably damaging Het
Ogg1 A T 6: 113,329,276 I145F probably damaging Het
Olfr1359 A G 13: 21,703,270 K90E possibly damaging Het
Olfr453 G A 6: 42,744,403 R122H probably benign Het
Olfr572 T C 7: 102,927,942 F105L probably damaging Het
Olfr976 T C 9: 39,956,345 T197A probably benign Het
Pclo A G 5: 14,713,447 D3978G unknown Het
Pla2g4e T G 2: 120,170,195 D687A probably damaging Het
Pla2r1 T C 2: 60,458,393 K632E probably damaging Het
Plg A T 17: 12,391,836 Q212L probably damaging Het
Poldip3 A T 15: 83,131,497 N306K probably damaging Het
Pspn A G 17: 56,999,978 L13P possibly damaging Het
Ralgapa1 T C 12: 55,758,059 E484G probably damaging Het
Rbmxl1 G T 8: 78,506,657 T19K probably damaging Het
Rora G A 9: 69,196,083 V31I possibly damaging Het
Skint5 C A 4: 113,940,839 W182C probably damaging Het
Spata31d1c A T 13: 65,036,063 Q473L probably damaging Het
Tesk2 G A 4: 116,802,687 W334* probably null Het
Tmem67 C A 4: 12,075,484 V277L probably benign Het
Trhde A G 10: 114,518,177 M537T probably damaging Het
Ttc30a2 A T 2: 75,976,269 L633* probably null Het
Tubb6 G A 18: 67,401,911 M293I probably benign Het
Ube2ql1 A T 13: 69,738,754 L196Q probably damaging Het
Ubn1 A T 16: 5,055,324 N70I probably damaging Het
Ubtf A T 11: 102,314,980 S40T probably benign Het
Virma C T 4: 11,519,249 A782V possibly damaging Het
Xdh G T 17: 73,943,873 T28K probably damaging Het
Xpo4 A G 14: 57,597,051 S691P probably benign Het
Zfat A C 15: 68,180,452 F491V probably damaging Het
Zfp623 T G 15: 75,948,305 V370G probably damaging Het
Other mutations in Akp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Akp3 APN 1 87127136 splice site probably benign
IGL02146:Akp3 APN 1 87126575 missense probably benign 0.00
IGL02216:Akp3 APN 1 87127650 missense probably damaging 1.00
IGL02677:Akp3 APN 1 87125272 missense probably damaging 1.00
IGL02716:Akp3 APN 1 87125479 missense probably damaging 1.00
IGL02943:Akp3 APN 1 87126369 nonsense probably null
IGL03099:Akp3 APN 1 87127606 missense probably benign 0.14
R0458:Akp3 UTSW 1 87126537 nonsense probably null
R0755:Akp3 UTSW 1 87127871 missense unknown
R0783:Akp3 UTSW 1 87127871 missense unknown
R0784:Akp3 UTSW 1 87127871 missense unknown
R1080:Akp3 UTSW 1 87127001 missense probably damaging 0.99
R1120:Akp3 UTSW 1 87125437 missense probably damaging 0.98
R1128:Akp3 UTSW 1 87127871 missense unknown
R1130:Akp3 UTSW 1 87127871 missense unknown
R1175:Akp3 UTSW 1 87127871 missense unknown
R1200:Akp3 UTSW 1 87125260 missense probably damaging 1.00
R1618:Akp3 UTSW 1 87127871 missense unknown
R1864:Akp3 UTSW 1 87127767 small deletion probably benign
R2111:Akp3 UTSW 1 87126885 intron probably null
R4657:Akp3 UTSW 1 87125834 intron probably benign
R5278:Akp3 UTSW 1 87125166 missense probably benign 0.01
R5563:Akp3 UTSW 1 87125924 missense probably damaging 1.00
R5643:Akp3 UTSW 1 87127763 missense unknown
R5768:Akp3 UTSW 1 87127122 missense probably damaging 0.99
R5809:Akp3 UTSW 1 87126548 missense probably benign 0.06
R5956:Akp3 UTSW 1 87126945 missense probably damaging 1.00
R5999:Akp3 UTSW 1 87127541 missense probably damaging 1.00
R6945:Akp3 UTSW 1 87125631 missense probably damaging 1.00
R7154:Akp3 UTSW 1 87125224 missense probably damaging 0.99
R7162:Akp3 UTSW 1 87127749 missense unknown
R7486:Akp3 UTSW 1 87125479 missense probably damaging 1.00
R7825:Akp3 UTSW 1 87127767 small deletion probably benign
X0018:Akp3 UTSW 1 87126338 missense probably damaging 1.00
X0060:Akp3 UTSW 1 87125894 missense probably damaging 1.00
X0066:Akp3 UTSW 1 87126796 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACTTCCTGCACTGGTACACC -3'
(R):5'- GGCTAAGTCGAACATCACAGC -3'

Sequencing Primer
(F):5'- TGCACTGGTACACCTCACATGG -3'
(R):5'- CCAGATAAGCTGTGCCCAGATG -3'
Posted On2019-05-13