Mutagenetix > Incidental Mutations

Incidental Mutation 'R7028:Akp3'

546093

Institutional Source

Beutler Lab

Gene Symbol

Akp3

Ensembl Gene

ENSMUSG00000036500

Gene Name

alkaline phosphatase 3, intestine, not Mn requiring

Synonyms

Akp-3, IAP

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.123) question?

Stock #

R7028 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

87124973-87127912 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 87126778 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 303 (M303V)

Ref Sequence

ENSEMBL: ENSMUSP00000037497 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044878]

Predicted Effect

probably benign
Transcript: ENSMUST00000044878
AA Change: M303V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000037497
Gene: ENSMUSG00000036500
AA Change: M303V

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	33	45	N/A	INTRINSIC
alkPPc	53	487	1.92e-249	SMART
low complexity region	503	524	N/A	INTRINSIC
low complexity region	533	557	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] There are at least four distinct but related alkaline phosphatases: intestinal, placental, placental-like, and liver/bone/kidney (tissue non-specific). The intestinal alkaline phosphatase gene encodes a digestive brush-border enzyme. This enzyme is a component of the gut mucosal defense system and is thought to function in the detoxification of lipopolysaccharide, and in the prevention of bacterial translocation in the gut. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for disruption of this gene show no gross abnormalities in appearance, behavior or fertility. They do display accelerated lipid absorption on a high fat diet leading to elevated plasma triglycerides and increased weight gain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	A	G	2: 69,265,675	I804T	probably benign	Het
Abcb1b	A	T	5: 8,805,441	E25V	probably damaging	Het
Adamts9	G	T	6: 92,909,793	Y355*	probably null	Het
Ankrd35	A	T	3: 96,683,334	E312V	possibly damaging	Het
Arhgap40	T	C	2: 158,531,374		probably null	Het
Asxl1	T	C	2: 153,400,107	L859P	probably benign	Het
Atat1	A	G	17: 35,910,005	F11L	probably benign	Het
Bach1	G	A	16: 87,719,291	R240Q	probably benign	Het
Ccdc7a	A	T	8: 128,881,594	H943Q	unknown	Het
Cep135	A	G	5: 76,616,848	T558A	probably benign	Het
Cfap99	A	G	5: 34,301,519	E86G	possibly damaging	Het
Cfhr2	C	T	1: 139,831,063		probably null	Het
Cmtm1	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	8: 104,309,470		probably benign	Het
Col17a1	G	A	19: 47,652,183	P992L	probably damaging	Het
Col7a1	C	T	9: 108,963,263	Q1294*	probably null	Het
Coq8b	T	A	7: 27,239,868	C148S	probably damaging	Het
Csmd2	A	G	4: 128,277,228	N338S		Het
Cspg5	T	A	9: 110,246,891	S232T	possibly damaging	Het
Cyp2c67	A	G	19: 39,639,897	V201A	possibly damaging	Het
Dlgap3	G	A	4: 127,195,517	R302H	possibly damaging	Het
Dpy19l2	T	C	9: 24,628,251	I469V	probably benign	Het
Fam135b	T	C	15: 71,471,563	D401G	probably damaging	Het
Gabbr1	G	T	17: 37,064,737	G453*	probably null	Het
Gclc	C	A	9: 77,788,216	A440D	probably damaging	Het
Glyat	T	C	19: 12,650,359	I106T	probably benign	Het
Gm12185	T	C	11: 48,908,244	N474S	possibly damaging	Het
Gm17079	T	C	14: 51,693,037	H117R		Het
Gm884	C	T	11: 103,614,537	A26T	probably benign	Het
Ildr2	A	G	1: 166,303,529	D318G	probably damaging	Het
Kcnd2	G	A	6: 21,216,178		probably benign	Het
Kif19a	C	T	11: 114,781,208	T207M	probably damaging	Het
Kif3a	G	T	11: 53,586,906	G401*	probably null	Het
Lactbl1	T	A	4: 136,632,975	L155Q	probably damaging	Het
Lrp1b	T	A	2: 41,246,011	D1649V	probably benign	Het
Map2k1	A	G	9: 64,193,823	V191A	probably benign	Het
Mdm4	A	T	1: 133,003,809	C165S	probably benign	Het
Med27	G	A	2: 29,509,434	W92*	probably null	Het
Muc20	A	T	16: 32,794,246	S254T	probably benign	Het
Myh1	A	G	11: 67,220,421	E1562G	possibly damaging	Het
Nlrp2	C	G	7: 5,328,572	R275P	possibly damaging	Het
Notch2	T	A	3: 98,102,387	N543K	probably damaging	Het
Nup214	T	A	2: 32,034,156	S1566T	probably benign	Het
Nxnl1	T	G	8: 71,562,793	E157A	possibly damaging	Het
Obscn	A	G	11: 59,079,133	L61P	probably damaging	Het
Ogg1	A	T	6: 113,329,276	I145F	probably damaging	Het
Olfr1359	A	G	13: 21,703,270	K90E	possibly damaging	Het
Olfr453	G	A	6: 42,744,403	R122H	probably benign	Het
Olfr572	T	C	7: 102,927,942	F105L	probably damaging	Het
Olfr976	T	C	9: 39,956,345	T197A	probably benign	Het
Pclo	A	G	5: 14,713,447	D3978G	unknown	Het
Pla2g4e	T	G	2: 120,170,195	D687A	probably damaging	Het
Pla2r1	T	C	2: 60,458,393	K632E	probably damaging	Het
Plg	A	T	17: 12,391,836	Q212L	probably damaging	Het
Poldip3	A	T	15: 83,131,497	N306K	probably damaging	Het
Pspn	A	G	17: 56,999,978	L13P	possibly damaging	Het
Ralgapa1	T	C	12: 55,758,059	E484G	probably damaging	Het
Rbmxl1	G	T	8: 78,506,657	T19K	probably damaging	Het
Rora	G	A	9: 69,196,083	V31I	possibly damaging	Het
Skint5	C	A	4: 113,940,839	W182C	probably damaging	Het
Spata31d1c	A	T	13: 65,036,063	Q473L	probably damaging	Het
Tesk2	G	A	4: 116,802,687	W334*	probably null	Het
Tmem67	C	A	4: 12,075,484	V277L	probably benign	Het
Trhde	A	G	10: 114,518,177	M537T	probably damaging	Het
Ttc30a2	A	T	2: 75,976,269	L633*	probably null	Het
Tubb6	G	A	18: 67,401,911	M293I	probably benign	Het
Ube2ql1	A	T	13: 69,738,754	L196Q	probably damaging	Het
Ubn1	A	T	16: 5,055,324	N70I	probably damaging	Het
Ubtf	A	T	11: 102,314,980	S40T	probably benign	Het
Virma	C	T	4: 11,519,249	A782V	possibly damaging	Het
Xdh	G	T	17: 73,943,873	T28K	probably damaging	Het
Xpo4	A	G	14: 57,597,051	S691P	probably benign	Het
Zfat	A	C	15: 68,180,452	F491V	probably damaging	Het
Zfp623	T	G	15: 75,948,305	V370G	probably damaging	Het

Other mutations in Akp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01343:Akp3	APN	1	87127136	splice site	probably benign
IGL02146:Akp3	APN	1	87126575	missense	probably benign	0.00
IGL02216:Akp3	APN	1	87127650	missense	probably damaging	1.00
IGL02677:Akp3	APN	1	87125272	missense	probably damaging	1.00
IGL02716:Akp3	APN	1	87125479	missense	probably damaging	1.00
IGL02943:Akp3	APN	1	87126369	nonsense	probably null
IGL03099:Akp3	APN	1	87127606	missense	probably benign	0.14
R0458:Akp3	UTSW	1	87126537	nonsense	probably null
R0755:Akp3	UTSW	1	87127871	missense	unknown
R0783:Akp3	UTSW	1	87127871	missense	unknown
R0784:Akp3	UTSW	1	87127871	missense	unknown
R1080:Akp3	UTSW	1	87127001	missense	probably damaging	0.99
R1120:Akp3	UTSW	1	87125437	missense	probably damaging	0.98
R1128:Akp3	UTSW	1	87127871	missense	unknown
R1130:Akp3	UTSW	1	87127871	missense	unknown
R1175:Akp3	UTSW	1	87127871	missense	unknown
R1200:Akp3	UTSW	1	87125260	missense	probably damaging	1.00
R1618:Akp3	UTSW	1	87127871	missense	unknown
R1864:Akp3	UTSW	1	87127767	small deletion	probably benign
R2111:Akp3	UTSW	1	87126885	splice site	probably null
R4657:Akp3	UTSW	1	87125834	intron	probably benign
R5278:Akp3	UTSW	1	87125166	missense	probably benign	0.01
R5563:Akp3	UTSW	1	87125924	missense	probably damaging	1.00
R5643:Akp3	UTSW	1	87127763	missense	unknown
R5768:Akp3	UTSW	1	87127122	missense	probably damaging	0.99
R5809:Akp3	UTSW	1	87126548	missense	probably benign	0.06
R5956:Akp3	UTSW	1	87126945	missense	probably damaging	1.00
R5999:Akp3	UTSW	1	87127541	missense	probably damaging	1.00
R6945:Akp3	UTSW	1	87125631	missense	probably damaging	1.00
R7154:Akp3	UTSW	1	87125224	missense	probably damaging	0.99
R7162:Akp3	UTSW	1	87127749	missense	unknown
R7486:Akp3	UTSW	1	87125479	missense	probably damaging	1.00
R7825:Akp3	UTSW	1	87127767	small deletion	probably benign
R8267:Akp3	UTSW	1	87127739	missense	unknown
X0018:Akp3	UTSW	1	87126338	missense	probably damaging	1.00
X0060:Akp3	UTSW	1	87125894	missense	probably damaging	1.00
X0066:Akp3	UTSW	1	87126796	missense	probably damaging	0.98
Z1177:Akp3	UTSW	1	87126445	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- ACTTCCTGCACTGGTACACC -3'
(R):5'- GGCTAAGTCGAACATCACAGC -3'

Sequencing Primer
(F):5'- TGCACTGGTACACCTCACATGG -3'
(R):5'- CCAGATAAGCTGTGCCCAGATG -3'

Posted On

2019-05-13