Mutagenetix > Incidental Mutation

Incidental Mutation 'R7028:Pla2r1'

546100

Institutional Source

Beutler Lab

Gene Symbol

Pla2r1

Ensembl Gene

ENSMUSG00000054580

Gene Name

phospholipase A2 receptor 1

Synonyms

M-type receptor, Pla2g1br, PLA2-I receptor

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7028 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

60417543-60553308 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 60458393 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 632 (K632E)

Ref Sequence

ENSEMBL: ENSMUSP00000108144 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112525]

AlphaFold

Q62028

Predicted Effect

probably damaging
Transcript: ENSMUST00000112525
AA Change: K632E

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000108144
Gene: ENSMUSG00000054580
AA Change: K632E

Domain	Start	End	E-Value	Type
low complexity region	35	62	N/A	INTRINSIC
RICIN	77	189	2.98e-16	SMART
FN2	209	257	1.17e-25	SMART
CLECT	267	392	7.66e-30	SMART
CLECT	415	539	1.88e-29	SMART
CLECT	552	679	5.42e-21	SMART
CLECT	699	832	3.58e-21	SMART
CLECT	847	973	7.55e-20	SMART
CLECT	992	1131	5.05e-30	SMART
CLECT	1148	1267	4.72e-21	SMART
CLECT	1281	1412	1.44e-25	SMART
transmembrane domain	1432	1454	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents a phospholipase A2 receptor. The encoded protein likely exists as both a transmembrane form and a soluble form. The transmembrane receptor may play a role in clearance of phospholipase A2, thereby inhibiting its action. Polymorphisms at this locus have been associated with susceptibility to idiopathic membranous nephropathy. Alternatively spliced transcript variants encoding different isoforms have been identified.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous null mice are viable and fertile with no overt abnormalities. These mice are more resistant to toxic effects of lipopolysaccharide than controls, suggesting a role for this gene in the progression of endotoxic shock. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	A	G	2: 69,265,675	I804T	probably benign	Het
Abcb1b	A	T	5: 8,805,441	E25V	probably damaging	Het
Adamts9	G	T	6: 92,909,793	Y355*	probably null	Het
Akp3	A	G	1: 87,126,778	M303V	probably benign	Het
Ankrd35	A	T	3: 96,683,334	E312V	possibly damaging	Het
Arhgap40	T	C	2: 158,531,374		probably null	Het
Asxl1	T	C	2: 153,400,107	L859P	probably benign	Het
Atat1	A	G	17: 35,910,005	F11L	probably benign	Het
Bach1	G	A	16: 87,719,291	R240Q	probably benign	Het
Ccdc7a	A	T	8: 128,881,594	H943Q	unknown	Het
Cep135	A	G	5: 76,616,848	T558A	probably benign	Het
Cfap99	A	G	5: 34,301,519	E86G	possibly damaging	Het
Cfhr2	C	T	1: 139,831,063		probably null	Het
Cmtm1	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	8: 104,309,470		probably benign	Het
Col17a1	G	A	19: 47,652,183	P992L	probably damaging	Het
Col7a1	C	T	9: 108,963,263	Q1294*	probably null	Het
Coq8b	T	A	7: 27,239,868	C148S	probably damaging	Het
Csmd2	A	G	4: 128,277,228	N338S		Het
Cspg5	T	A	9: 110,246,891	S232T	possibly damaging	Het
Cyp2c67	A	G	19: 39,639,897	V201A	possibly damaging	Het
Dlgap3	G	A	4: 127,195,517	R302H	possibly damaging	Het
Dpy19l2	T	C	9: 24,628,251	I469V	probably benign	Het
Fam135b	T	C	15: 71,471,563	D401G	probably damaging	Het
Gabbr1	G	T	17: 37,064,737	G453*	probably null	Het
Gclc	C	A	9: 77,788,216	A440D	probably damaging	Het
Glyat	T	C	19: 12,650,359	I106T	probably benign	Het
Gm12185	T	C	11: 48,908,244	N474S	possibly damaging	Het
Gm17079	T	C	14: 51,693,037	H117R		Het
Gm884	C	T	11: 103,614,537	A26T	probably benign	Het
Ildr2	A	G	1: 166,303,529	D318G	probably damaging	Het
Kcnd2	G	A	6: 21,216,178		probably benign	Het
Kif19a	C	T	11: 114,781,208	T207M	probably damaging	Het
Kif3a	G	T	11: 53,586,906	G401*	probably null	Het
Lactbl1	T	A	4: 136,632,975	L155Q	probably damaging	Het
Lrp1b	T	A	2: 41,246,011	D1649V	probably benign	Het
Map2k1	A	G	9: 64,193,823	V191A	probably benign	Het
Mdm4	A	T	1: 133,003,809	C165S	probably benign	Het
Med27	G	A	2: 29,509,434	W92*	probably null	Het
Muc20	A	T	16: 32,794,246	S254T	probably benign	Het
Myh1	A	G	11: 67,220,421	E1562G	possibly damaging	Het
Nlrp2	C	G	7: 5,328,572	R275P	possibly damaging	Het
Notch2	T	A	3: 98,102,387	N543K	probably damaging	Het
Nup214	T	A	2: 32,034,156	S1566T	probably benign	Het
Nxnl1	T	G	8: 71,562,793	E157A	possibly damaging	Het
Obscn	A	G	11: 59,079,133	L61P	probably damaging	Het
Ogg1	A	T	6: 113,329,276	I145F	probably damaging	Het
Olfr1359	A	G	13: 21,703,270	K90E	possibly damaging	Het
Olfr453	G	A	6: 42,744,403	R122H	probably benign	Het
Olfr572	T	C	7: 102,927,942	F105L	probably damaging	Het
Olfr976	T	C	9: 39,956,345	T197A	probably benign	Het
Pclo	A	G	5: 14,713,447	D3978G	unknown	Het
Pla2g4e	T	G	2: 120,170,195	D687A	probably damaging	Het
Plg	A	T	17: 12,391,836	Q212L	probably damaging	Het
Poldip3	A	T	15: 83,131,497	N306K	probably damaging	Het
Pspn	A	G	17: 56,999,978	L13P	possibly damaging	Het
Ralgapa1	T	C	12: 55,758,059	E484G	probably damaging	Het
Rbmxl1	G	T	8: 78,506,657	T19K	probably damaging	Het
Rora	G	A	9: 69,196,083	V31I	possibly damaging	Het
Skint5	C	A	4: 113,940,839	W182C	probably damaging	Het
Spata31d1c	A	T	13: 65,036,063	Q473L	probably damaging	Het
Tesk2	G	A	4: 116,802,687	W334*	probably null	Het
Tmem67	C	A	4: 12,075,484	V277L	probably benign	Het
Trhde	A	G	10: 114,518,177	M537T	probably damaging	Het
Ttc30a2	A	T	2: 75,976,269	L633*	probably null	Het
Tubb6	G	A	18: 67,401,911	M293I	probably benign	Het
Ube2ql1	A	T	13: 69,738,754	L196Q	probably damaging	Het
Ubn1	A	T	16: 5,055,324	N70I	probably damaging	Het
Ubtf	A	T	11: 102,314,980	S40T	probably benign	Het
Virma	C	T	4: 11,519,249	A782V	possibly damaging	Het
Xdh	G	T	17: 73,943,873	T28K	probably damaging	Het
Xpo4	A	G	14: 57,597,051	S691P	probably benign	Het
Zfat	A	C	15: 68,180,452	F491V	probably damaging	Het
Zfp623	T	G	15: 75,948,305	V370G	probably damaging	Het

Other mutations in Pla2r1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00569:Pla2r1	APN	2	60420425	missense	probably benign
IGL00886:Pla2r1	APN	2	60424324	missense	probably damaging	1.00
IGL00928:Pla2r1	APN	2	60535080	missense	probably damaging	0.99
IGL01361:Pla2r1	APN	2	60479470	missense	probably damaging	1.00
IGL01403:Pla2r1	APN	2	60424288	missense	probably damaging	0.99
IGL01475:Pla2r1	APN	2	60441081	splice site	probably benign
IGL01517:Pla2r1	APN	2	60504253	missense	probably damaging	1.00
IGL01646:Pla2r1	APN	2	60495364	missense	probably damaging	1.00
IGL02208:Pla2r1	APN	2	60428588	missense	possibly damaging	0.81
IGL02301:Pla2r1	APN	2	60452436	missense	probably benign	0.01
IGL02522:Pla2r1	APN	2	60428669	missense	probably benign	0.11
IGL02688:Pla2r1	APN	2	60455201	missense	probably damaging	1.00
IGL02822:Pla2r1	APN	2	60455173	missense	probably damaging	1.00
IGL02850:Pla2r1	APN	2	60502069	missense	probably benign	0.03
IGL03233:Pla2r1	APN	2	60428580	missense	possibly damaging	0.63
IGL03350:Pla2r1	APN	2	60455173	missense	probably damaging	1.00
IGL02980:Pla2r1	UTSW	2	60515046	missense	possibly damaging	0.77
R0105:Pla2r1	UTSW	2	60514981	missense	possibly damaging	0.89
R0105:Pla2r1	UTSW	2	60514981	missense	possibly damaging	0.89
R0387:Pla2r1	UTSW	2	60432601	missense	probably benign	0.03
R0522:Pla2r1	UTSW	2	60479515	missense	probably benign	0.01
R0550:Pla2r1	UTSW	2	60425350	critical splice donor site	probably null
R0718:Pla2r1	UTSW	2	60479530	missense	possibly damaging	0.55
R0906:Pla2r1	UTSW	2	60514947	missense	possibly damaging	0.79
R0945:Pla2r1	UTSW	2	60458410	missense	possibly damaging	0.89
R1229:Pla2r1	UTSW	2	60534762	missense	probably benign	0.09
R1397:Pla2r1	UTSW	2	60534762	missense	probably benign	0.09
R1667:Pla2r1	UTSW	2	60420257	missense	probably benign	0.00
R1668:Pla2r1	UTSW	2	60428646	missense	probably damaging	0.99
R1694:Pla2r1	UTSW	2	60441084	critical splice donor site	probably null
R1864:Pla2r1	UTSW	2	60428711	missense	probably benign	0.01
R2029:Pla2r1	UTSW	2	60431973	missense	probably damaging	0.99
R2035:Pla2r1	UTSW	2	60422736	missense	probably damaging	1.00
R2207:Pla2r1	UTSW	2	60458435	missense	probably damaging	1.00
R2429:Pla2r1	UTSW	2	60514968	missense	probably damaging	1.00
R3196:Pla2r1	UTSW	2	60522783	missense	probably damaging	1.00
R3522:Pla2r1	UTSW	2	60448906	missense	probably damaging	1.00
R3973:Pla2r1	UTSW	2	60448962	missense	probably benign	0.30
R4006:Pla2r1	UTSW	2	60522873	missense	probably damaging	1.00
R4091:Pla2r1	UTSW	2	60432593	missense	probably damaging	1.00
R4158:Pla2r1	UTSW	2	60422622	missense	probably damaging	0.97
R4160:Pla2r1	UTSW	2	60422622	missense	probably damaging	0.97
R4168:Pla2r1	UTSW	2	60497614	nonsense	probably null
R4541:Pla2r1	UTSW	2	60427738	missense	probably damaging	1.00
R4712:Pla2r1	UTSW	2	60428650	missense	probably damaging	1.00
R4797:Pla2r1	UTSW	2	60504180	missense	possibly damaging	0.47
R4884:Pla2r1	UTSW	2	60534984	missense	probably damaging	1.00
R4923:Pla2r1	UTSW	2	60422712	missense	probably benign	0.31
R5017:Pla2r1	UTSW	2	60522760	splice site	probably null
R5116:Pla2r1	UTSW	2	60448906	missense	probably damaging	1.00
R5641:Pla2r1	UTSW	2	60514984	missense	probably damaging	1.00
R5807:Pla2r1	UTSW	2	60428721	missense	possibly damaging	0.78
R5898:Pla2r1	UTSW	2	60422760	missense	probably damaging	1.00
R6241:Pla2r1	UTSW	2	60502199	splice site	probably null
R6923:Pla2r1	UTSW	2	60514966	missense	probably benign	0.11
R7020:Pla2r1	UTSW	2	60447399	missense	possibly damaging	0.79
R7257:Pla2r1	UTSW	2	60427625	critical splice donor site	probably null
R7291:Pla2r1	UTSW	2	60530435	missense	probably benign	0.43
R7350:Pla2r1	UTSW	2	60458379	missense	probably benign	0.02
R7451:Pla2r1	UTSW	2	60535002	missense	probably damaging	1.00
R7553:Pla2r1	UTSW	2	60522899	missense	possibly damaging	0.80
R7635:Pla2r1	UTSW	2	60534762	missense	probably benign	0.09
R7768:Pla2r1	UTSW	2	60448946	missense	probably benign	0.22
R7774:Pla2r1	UTSW	2	60530458	nonsense	probably null
R7782:Pla2r1	UTSW	2	60504187	missense	probably benign	0.01
R7832:Pla2r1	UTSW	2	60504192	missense	possibly damaging	0.79
R7843:Pla2r1	UTSW	2	60447475	missense	possibly damaging	0.88
R7900:Pla2r1	UTSW	2	60428514	missense	possibly damaging	0.94
R8010:Pla2r1	UTSW	2	60514960	missense	probably benign	0.00
R8129:Pla2r1	UTSW	2	60432600	missense	probably damaging	1.00
R8336:Pla2r1	UTSW	2	60422683	missense	possibly damaging	0.88
R8347:Pla2r1	UTSW	2	60534903	missense	probably damaging	0.98
R8359:Pla2r1	UTSW	2	60443283	missense	probably benign	0.00
R8682:Pla2r1	UTSW	2	60422776	missense	possibly damaging	0.89
R8845:Pla2r1	UTSW	2	60428709	missense	possibly damaging	0.52
R8901:Pla2r1	UTSW	2	60502056	missense
R9085:Pla2r1	UTSW	2	60425447	missense	probably damaging	0.99
R9130:Pla2r1	UTSW	2	60495385	intron	probably benign
R9140:Pla2r1	UTSW	2	60441111	missense	probably benign	0.10
R9399:Pla2r1	UTSW	2	60452400	critical splice donor site	probably null
R9449:Pla2r1	UTSW	2	60428558	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATATGCTGTGTACCAGGCCC -3'
(R):5'- TGTGCCAATGAAGCATCTTTC -3'

Sequencing Primer
(F):5'- GCCCTGTGACAGAAAGCTTAG -3'
(R):5'- GTGCCAATGAAGCATCTTTCTTCATC -3'

Posted On

2019-05-13