Mutagenetix > Incidental Mutation

Incidental Mutation 'R7028:Abcb11'

546101

Institutional Source

Beutler Lab

Gene Symbol

Abcb11

Ensembl Gene

ENSMUSG00000027048

Gene Name

ATP-binding cassette, sub-family B (MDR/TAP), member 11

Synonyms

PFIC2, Bsep, PGY4, Lith1, ABC16, sister of P-glycoprotein

MMRRC Submission

Accession Numbers

Genbank: NM_021022; MGI: 1351619

Essential gene?

Possibly essential (E-score: 0.602) question?

Stock #

R7028 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

69238282-69342616 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 69265675 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 804 (I804T)

Ref Sequence

ENSEMBL: ENSMUSP00000137017 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102709] [ENSMUST00000102710] [ENSMUST00000180142]

AlphaFold

Q9QY30

Predicted Effect

probably benign
Transcript: ENSMUST00000102709
AA Change: I804T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000099770
Gene: ENSMUSG00000027048
AA Change: I804T

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	62	373	1.3e-65	PFAM
AAA	447	639	1.65e-17	SMART
Pfam:ABC_membrane	755	1031	2.7e-55	PFAM
AAA	1105	1299	1.9e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000102710
AA Change: I804T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000099771
Gene: ENSMUSG00000027048
AA Change: I804T

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	62	371	1.7e-72	PFAM
AAA	447	639	1.65e-17	SMART
Pfam:ABC_membrane	755	1029	3.2e-59	PFAM
AAA	1105	1299	1.9e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000180142
AA Change: I804T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000137017
Gene: ENSMUSG00000027048
AA Change: I804T

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	62	371	1.4e-72	PFAM
AAA	447	639	1.65e-17	SMART
Pfam:ABC_membrane	755	1029	2.5e-59	PFAM
AAA	1105	1299	1.9e-17	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is the major canalicular bile salt transporter in humans and mice. Mutations in the human gene cause a form of progressive familial intrahepatic cholestases which are a group of inherited disorders with severe cholestatic liver disease from early infancy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display intrahepatic cholestasis. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb1b	A	T	5: 8,805,441	E25V	probably damaging	Het
Adamts9	G	T	6: 92,909,793	Y355*	probably null	Het
Akp3	A	G	1: 87,126,778	M303V	probably benign	Het
Ankrd35	A	T	3: 96,683,334	E312V	possibly damaging	Het
Arhgap40	T	C	2: 158,531,374		probably null	Het
Asxl1	T	C	2: 153,400,107	L859P	probably benign	Het
Atat1	A	G	17: 35,910,005	F11L	probably benign	Het
Bach1	G	A	16: 87,719,291	R240Q	probably benign	Het
Ccdc7a	A	T	8: 128,881,594	H943Q	unknown	Het
Cep135	A	G	5: 76,616,848	T558A	probably benign	Het
Cfap99	A	G	5: 34,301,519	E86G	possibly damaging	Het
Cfhr2	C	T	1: 139,831,063		probably null	Het
Cmtm1	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	8: 104,309,470		probably benign	Het
Col17a1	G	A	19: 47,652,183	P992L	probably damaging	Het
Col7a1	C	T	9: 108,963,263	Q1294*	probably null	Het
Coq8b	T	A	7: 27,239,868	C148S	probably damaging	Het
Csmd2	A	G	4: 128,277,228	N338S		Het
Cspg5	T	A	9: 110,246,891	S232T	possibly damaging	Het
Cyp2c67	A	G	19: 39,639,897	V201A	possibly damaging	Het
Dlgap3	G	A	4: 127,195,517	R302H	possibly damaging	Het
Dpy19l2	T	C	9: 24,628,251	I469V	probably benign	Het
Fam135b	T	C	15: 71,471,563	D401G	probably damaging	Het
Gabbr1	G	T	17: 37,064,737	G453*	probably null	Het
Gclc	C	A	9: 77,788,216	A440D	probably damaging	Het
Glyat	T	C	19: 12,650,359	I106T	probably benign	Het
Gm12185	T	C	11: 48,908,244	N474S	possibly damaging	Het
Gm17079	T	C	14: 51,693,037	H117R		Het
Gm884	C	T	11: 103,614,537	A26T	probably benign	Het
Ildr2	A	G	1: 166,303,529	D318G	probably damaging	Het
Kcnd2	G	A	6: 21,216,178		probably benign	Het
Kif19a	C	T	11: 114,781,208	T207M	probably damaging	Het
Kif3a	G	T	11: 53,586,906	G401*	probably null	Het
Lactbl1	T	A	4: 136,632,975	L155Q	probably damaging	Het
Lrp1b	T	A	2: 41,246,011	D1649V	probably benign	Het
Map2k1	A	G	9: 64,193,823	V191A	probably benign	Het
Mdm4	A	T	1: 133,003,809	C165S	probably benign	Het
Med27	G	A	2: 29,509,434	W92*	probably null	Het
Muc20	A	T	16: 32,794,246	S254T	probably benign	Het
Myh1	A	G	11: 67,220,421	E1562G	possibly damaging	Het
Nlrp2	C	G	7: 5,328,572	R275P	possibly damaging	Het
Notch2	T	A	3: 98,102,387	N543K	probably damaging	Het
Nup214	T	A	2: 32,034,156	S1566T	probably benign	Het
Nxnl1	T	G	8: 71,562,793	E157A	possibly damaging	Het
Obscn	A	G	11: 59,079,133	L61P	probably damaging	Het
Ogg1	A	T	6: 113,329,276	I145F	probably damaging	Het
Olfr1359	A	G	13: 21,703,270	K90E	possibly damaging	Het
Olfr453	G	A	6: 42,744,403	R122H	probably benign	Het
Olfr572	T	C	7: 102,927,942	F105L	probably damaging	Het
Olfr976	T	C	9: 39,956,345	T197A	probably benign	Het
Pclo	A	G	5: 14,713,447	D3978G	unknown	Het
Pla2g4e	T	G	2: 120,170,195	D687A	probably damaging	Het
Pla2r1	T	C	2: 60,458,393	K632E	probably damaging	Het
Plg	A	T	17: 12,391,836	Q212L	probably damaging	Het
Poldip3	A	T	15: 83,131,497	N306K	probably damaging	Het
Pspn	A	G	17: 56,999,978	L13P	possibly damaging	Het
Ralgapa1	T	C	12: 55,758,059	E484G	probably damaging	Het
Rbmxl1	G	T	8: 78,506,657	T19K	probably damaging	Het
Rora	G	A	9: 69,196,083	V31I	possibly damaging	Het
Skint5	C	A	4: 113,940,839	W182C	probably damaging	Het
Spata31d1c	A	T	13: 65,036,063	Q473L	probably damaging	Het
Tesk2	G	A	4: 116,802,687	W334*	probably null	Het
Tmem67	C	A	4: 12,075,484	V277L	probably benign	Het
Trhde	A	G	10: 114,518,177	M537T	probably damaging	Het
Ttc30a2	A	T	2: 75,976,269	L633*	probably null	Het
Tubb6	G	A	18: 67,401,911	M293I	probably benign	Het
Ube2ql1	A	T	13: 69,738,754	L196Q	probably damaging	Het
Ubn1	A	T	16: 5,055,324	N70I	probably damaging	Het
Ubtf	A	T	11: 102,314,980	S40T	probably benign	Het
Virma	C	T	4: 11,519,249	A782V	possibly damaging	Het
Xdh	G	T	17: 73,943,873	T28K	probably damaging	Het
Xpo4	A	G	14: 57,597,051	S691P	probably benign	Het
Zfat	A	C	15: 68,180,452	F491V	probably damaging	Het
Zfp623	T	G	15: 75,948,305	V370G	probably damaging	Het

Other mutations in Abcb11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00544:Abcb11	APN	2	69284681	missense	possibly damaging	0.90
IGL01407:Abcb11	APN	2	69245944	missense	probably damaging	1.00
IGL01583:Abcb11	APN	2	69296409	missense	possibly damaging	0.81
IGL01813:Abcb11	APN	2	69287592	splice site	probably benign
IGL01885:Abcb11	APN	2	69287627	missense	probably damaging	1.00
IGL01937:Abcb11	APN	2	69287612	missense	probably damaging	1.00
IGL02058:Abcb11	APN	2	69243498	missense	probably damaging	0.98
IGL02117:Abcb11	APN	2	69323825	splice site	probably benign
IGL02119:Abcb11	APN	2	69328000	critical splice acceptor site	probably null
IGL02120:Abcb11	APN	2	69257310	missense	probably damaging	1.00
IGL02158:Abcb11	APN	2	69299925	missense	probably damaging	0.96
IGL02212:Abcb11	APN	2	69248889	missense	probably damaging	0.97
IGL02306:Abcb11	APN	2	69265457	nonsense	probably null
IGL02505:Abcb11	APN	2	69245761	missense	probably damaging	1.00
IGL02538:Abcb11	APN	2	69306605	missense	possibly damaging	0.67
IGL02793:Abcb11	APN	2	69291949	missense	possibly damaging	0.90
IGL02863:Abcb11	APN	2	69284682	missense	probably damaging	0.99
IGL02875:Abcb11	APN	2	69291949	missense	possibly damaging	0.90
IGL03164:Abcb11	APN	2	69291999	nonsense	probably null
IGL03181:Abcb11	APN	2	69328008	intron	probably benign
3-1:Abcb11	UTSW	2	69327993	missense	probably benign	0.00
FR4737:Abcb11	UTSW	2	69243518	missense	probably damaging	0.97
R0031:Abcb11	UTSW	2	69285308	missense	probably damaging	1.00
R0398:Abcb11	UTSW	2	69286666	missense	probably null	0.82
R0413:Abcb11	UTSW	2	69328011	intron	probably benign
R0437:Abcb11	UTSW	2	69257295	missense	probably damaging	1.00
R0496:Abcb11	UTSW	2	69277884	splice site	probably benign
R0646:Abcb11	UTSW	2	69285283	missense	probably damaging	1.00
R0669:Abcb11	UTSW	2	69329318	missense	probably benign	0.15
R0856:Abcb11	UTSW	2	69323918	missense	probably benign
R1061:Abcb11	UTSW	2	69277809	missense	probably benign	0.00
R1460:Abcb11	UTSW	2	69257374	splice site	probably benign
R1714:Abcb11	UTSW	2	69306581	missense	probably damaging	0.99
R1739:Abcb11	UTSW	2	69261566	missense	probably damaging	1.00
R1856:Abcb11	UTSW	2	69245923	missense	probably damaging	1.00
R1994:Abcb11	UTSW	2	69282670	splice site	probably null
R2086:Abcb11	UTSW	2	69259476	splice site	probably benign
R2133:Abcb11	UTSW	2	69323883	missense	possibly damaging	0.65
R2516:Abcb11	UTSW	2	69329329	missense	possibly damaging	0.88
R2930:Abcb11	UTSW	2	69257358	missense	probably damaging	0.96
R3771:Abcb11	UTSW	2	69329376	splice site	probably benign
R3772:Abcb11	UTSW	2	69329376	splice site	probably benign
R3979:Abcb11	UTSW	2	69323976	missense	probably benign	0.11
R4227:Abcb11	UTSW	2	69284776	missense	probably damaging	1.00
R4255:Abcb11	UTSW	2	69306605	missense	probably benign	0.03
R4614:Abcb11	UTSW	2	69284681	missense	possibly damaging	0.90
R4647:Abcb11	UTSW	2	69285271	missense	probably damaging	1.00
R4719:Abcb11	UTSW	2	69259627	missense	probably damaging	1.00
R4734:Abcb11	UTSW	2	69323962	missense	possibly damaging	0.73
R4765:Abcb11	UTSW	2	69245867	missense	probably damaging	1.00
R4861:Abcb11	UTSW	2	69245905	missense	probably damaging	1.00
R4861:Abcb11	UTSW	2	69245905	missense	probably damaging	1.00
R4870:Abcb11	UTSW	2	69239196	missense	probably damaging	0.99
R4988:Abcb11	UTSW	2	69323892	missense	probably benign	0.12
R5028:Abcb11	UTSW	2	69274012	missense	probably damaging	1.00
R5048:Abcb11	UTSW	2	69308506	missense	probably benign	0.06
R5177:Abcb11	UTSW	2	69285295	missense	probably damaging	1.00
R5301:Abcb11	UTSW	2	69286847	missense	probably damaging	0.98
R5789:Abcb11	UTSW	2	69245764	missense	probably damaging	1.00
R5892:Abcb11	UTSW	2	69261500	missense	probably damaging	0.99
R6003:Abcb11	UTSW	2	69243467	missense	probably benign	0.43
R6252:Abcb11	UTSW	2	69291961	missense	probably benign	0.10
R6389:Abcb11	UTSW	2	69323894	missense	probably damaging	1.00
R6512:Abcb11	UTSW	2	69282652	missense	probably benign
R6590:Abcb11	UTSW	2	69284718	missense	probably damaging	1.00
R6690:Abcb11	UTSW	2	69284718	missense	probably damaging	1.00
R6732:Abcb11	UTSW	2	69286846	missense	probably damaging	1.00
R6870:Abcb11	UTSW	2	69285298	missense	possibly damaging	0.91
R7223:Abcb11	UTSW	2	69274143	missense	probably benign
R7323:Abcb11	UTSW	2	69287635	missense	probably damaging	1.00
R7337:Abcb11	UTSW	2	69245769	missense	probably damaging	1.00
R7339:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7340:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7341:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7343:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7366:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7393:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7394:Abcb11	UTSW	2	69299867	missense	probably damaging	0.99
R7405:Abcb11	UTSW	2	69287619	missense	probably damaging	1.00
R7411:Abcb11	UTSW	2	69303936	critical splice donor site	probably null
R7488:Abcb11	UTSW	2	69277802	missense	probably benign
R7544:Abcb11	UTSW	2	69265486	missense	probably benign	0.05
R7660:Abcb11	UTSW	2	69287594	splice site	probably null
R7754:Abcb11	UTSW	2	69286818	missense	probably damaging	1.00
R7771:Abcb11	UTSW	2	69239191	missense	probably damaging	0.99
R7794:Abcb11	UTSW	2	69286678	missense	possibly damaging	0.62
R7834:Abcb11	UTSW	2	69284724	missense	probably damaging	1.00
R7897:Abcb11	UTSW	2	69323872	frame shift	probably null
R7897:Abcb11	UTSW	2	69323873	small deletion	probably benign
R7937:Abcb11	UTSW	2	69323873	small deletion	probably benign
R8004:Abcb11	UTSW	2	69257210	missense	possibly damaging	0.68
R8089:Abcb11	UTSW	2	69274039	missense	probably benign	0.09
R8279:Abcb11	UTSW	2	69239205	missense	probably benign	0.05
R8426:Abcb11	UTSW	2	69325262	missense	probably benign
R8441:Abcb11	UTSW	2	69257230	missense	possibly damaging	0.93
R8460:Abcb11	UTSW	2	69324037	missense	possibly damaging	0.70
R8462:Abcb11	UTSW	2	69274155	missense	probably benign
R8532:Abcb11	UTSW	2	69259691	missense	possibly damaging	0.69
R8534:Abcb11	UTSW	2	69323846	missense	possibly damaging	0.89
R8711:Abcb11	UTSW	2	69265512	missense	probably damaging	1.00
R8746:Abcb11	UTSW	2	69257410	intron	probably benign
R8964:Abcb11	UTSW	2	69286717	missense	possibly damaging	0.52
R8990:Abcb11	UTSW	2	69274150	missense
R9081:Abcb11	UTSW	2	69292044	missense	possibly damaging	0.59
R9093:Abcb11	UTSW	2	69239169	missense	probably damaging	0.97
R9228:Abcb11	UTSW	2	69308465	nonsense	probably null
R9294:Abcb11	UTSW	2	69265496	missense	possibly damaging	0.89
X0058:Abcb11	UTSW	2	69289443	missense	probably benign	0.12
X0062:Abcb11	UTSW	2	69245906	missense	probably damaging	1.00
X0065:Abcb11	UTSW	2	69299866	missense	probably damaging	0.99
Z1176:Abcb11	UTSW	2	69291981	missense	probably damaging	1.00
Z1177:Abcb11	UTSW	2	69306529	missense	probably damaging	1.00
Z1177:Abcb11	UTSW	2	69329269	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- CTTGAAACCAAATTTACGCAGC -3'
(R):5'- CTAGTGTGTTTAAAGTGAAGCCG -3'

Sequencing Primer
(F):5'- CAAATTTACGCAGCCTTTTTGTGAGG -3'
(R):5'- AGCTGATGTTCTACACTGACACG -3'

Posted On

2019-05-13