Mutagenetix > Incidental Mutations

Incidental Mutation 'R7028:Asxl1'

546104

Institutional Source

Beutler Lab

Gene Symbol

Asxl1

Ensembl Gene

ENSMUSG00000042548

Gene Name

additional sex combs like 1

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7028 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

153345829-153404007 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 153400107 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 859 (L859P)

Ref Sequence

ENSEMBL: ENSMUSP00000154224 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109790] [ENSMUST00000227428]

AlphaFold

P59598

Predicted Effect

probably benign
Transcript: ENSMUST00000109790
AA Change: L860P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000105413
Gene: ENSMUSG00000042548
AA Change: L860P

Domain	Start	End	E-Value	Type
Pfam:HARE-HTH	11	83	1.6e-20	PFAM
low complexity region	199	209	N/A	INTRINSIC
Pfam:ASXH	236	361	5.9e-40	PFAM
low complexity region	411	422	N/A	INTRINSIC
low complexity region	639	667	N/A	INTRINSIC
low complexity region	705	716	N/A	INTRINSIC
low complexity region	848	860	N/A	INTRINSIC
low complexity region	986	1000	N/A	INTRINSIC
Pfam:PHD_3	1446	1512	6.3e-23	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000227428
AA Change: L859P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to the Drosophila additional sex combs gene, which encodes a chromatin-binding protein required for normal determination of segment identity in the developing embryo. The protein is a member of the Polycomb group of proteins, which are necessary for the maintenance of stable repression of homeotic and other loci. The protein is thought to disrupt chromatin in localized areas, enhancing transcription of certain genes while repressing the transcription of other genes. The protein encoded by this gene functions as a ligand-dependent co-activator for retinoic acid receptor in cooperation with nuclear receptor coactivator 1. Mutations in this gene are associated with myelodysplastic syndromes and chronic myelomonocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Disruption of this gene causes alterations in lymphocyte development in adult mice. Mice homozygous for a different knock-out allele exhibit complete lethality. Mice heterozygous for this allele exhibit eye opacity and abnormal vertebrae morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	A	G	2: 69,265,675	I804T	probably benign	Het
Abcb1b	A	T	5: 8,805,441	E25V	probably damaging	Het
Adamts9	G	T	6: 92,909,793	Y355*	probably null	Het
Akp3	A	G	1: 87,126,778	M303V	probably benign	Het
Ankrd35	A	T	3: 96,683,334	E312V	possibly damaging	Het
Arhgap40	T	C	2: 158,531,374		probably null	Het
Atat1	A	G	17: 35,910,005	F11L	probably benign	Het
Bach1	G	A	16: 87,719,291	R240Q	probably benign	Het
Ccdc7a	A	T	8: 128,881,594	H943Q	unknown	Het
Cep135	A	G	5: 76,616,848	T558A	probably benign	Het
Cfap99	A	G	5: 34,301,519	E86G	possibly damaging	Het
Cfhr2	C	T	1: 139,831,063		probably null	Het
Cmtm1	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	8: 104,309,470		probably benign	Het
Col17a1	G	A	19: 47,652,183	P992L	probably damaging	Het
Col7a1	C	T	9: 108,963,263	Q1294*	probably null	Het
Coq8b	T	A	7: 27,239,868	C148S	probably damaging	Het
Csmd2	A	G	4: 128,277,228	N338S		Het
Cspg5	T	A	9: 110,246,891	S232T	possibly damaging	Het
Cyp2c67	A	G	19: 39,639,897	V201A	possibly damaging	Het
Dlgap3	G	A	4: 127,195,517	R302H	possibly damaging	Het
Dpy19l2	T	C	9: 24,628,251	I469V	probably benign	Het
Fam135b	T	C	15: 71,471,563	D401G	probably damaging	Het
Gabbr1	G	T	17: 37,064,737	G453*	probably null	Het
Gclc	C	A	9: 77,788,216	A440D	probably damaging	Het
Glyat	T	C	19: 12,650,359	I106T	probably benign	Het
Gm12185	T	C	11: 48,908,244	N474S	possibly damaging	Het
Gm17079	T	C	14: 51,693,037	H117R		Het
Gm884	C	T	11: 103,614,537	A26T	probably benign	Het
Ildr2	A	G	1: 166,303,529	D318G	probably damaging	Het
Kcnd2	G	A	6: 21,216,178		probably benign	Het
Kif19a	C	T	11: 114,781,208	T207M	probably damaging	Het
Kif3a	G	T	11: 53,586,906	G401*	probably null	Het
Lactbl1	T	A	4: 136,632,975	L155Q	probably damaging	Het
Lrp1b	T	A	2: 41,246,011	D1649V	probably benign	Het
Map2k1	A	G	9: 64,193,823	V191A	probably benign	Het
Mdm4	A	T	1: 133,003,809	C165S	probably benign	Het
Med27	G	A	2: 29,509,434	W92*	probably null	Het
Muc20	A	T	16: 32,794,246	S254T	probably benign	Het
Myh1	A	G	11: 67,220,421	E1562G	possibly damaging	Het
Nlrp2	C	G	7: 5,328,572	R275P	possibly damaging	Het
Notch2	T	A	3: 98,102,387	N543K	probably damaging	Het
Nup214	T	A	2: 32,034,156	S1566T	probably benign	Het
Nxnl1	T	G	8: 71,562,793	E157A	possibly damaging	Het
Obscn	A	G	11: 59,079,133	L61P	probably damaging	Het
Ogg1	A	T	6: 113,329,276	I145F	probably damaging	Het
Olfr1359	A	G	13: 21,703,270	K90E	possibly damaging	Het
Olfr453	G	A	6: 42,744,403	R122H	probably benign	Het
Olfr572	T	C	7: 102,927,942	F105L	probably damaging	Het
Olfr976	T	C	9: 39,956,345	T197A	probably benign	Het
Pclo	A	G	5: 14,713,447	D3978G	unknown	Het
Pla2g4e	T	G	2: 120,170,195	D687A	probably damaging	Het
Pla2r1	T	C	2: 60,458,393	K632E	probably damaging	Het
Plg	A	T	17: 12,391,836	Q212L	probably damaging	Het
Poldip3	A	T	15: 83,131,497	N306K	probably damaging	Het
Pspn	A	G	17: 56,999,978	L13P	possibly damaging	Het
Ralgapa1	T	C	12: 55,758,059	E484G	probably damaging	Het
Rbmxl1	G	T	8: 78,506,657	T19K	probably damaging	Het
Rora	G	A	9: 69,196,083	V31I	possibly damaging	Het
Skint5	C	A	4: 113,940,839	W182C	probably damaging	Het
Spata31d1c	A	T	13: 65,036,063	Q473L	probably damaging	Het
Tesk2	G	A	4: 116,802,687	W334*	probably null	Het
Tmem67	C	A	4: 12,075,484	V277L	probably benign	Het
Trhde	A	G	10: 114,518,177	M537T	probably damaging	Het
Ttc30a2	A	T	2: 75,976,269	L633*	probably null	Het
Tubb6	G	A	18: 67,401,911	M293I	probably benign	Het
Ube2ql1	A	T	13: 69,738,754	L196Q	probably damaging	Het
Ubn1	A	T	16: 5,055,324	N70I	probably damaging	Het
Ubtf	A	T	11: 102,314,980	S40T	probably benign	Het
Virma	C	T	4: 11,519,249	A782V	possibly damaging	Het
Xdh	G	T	17: 73,943,873	T28K	probably damaging	Het
Xpo4	A	G	14: 57,597,051	S691P	probably benign	Het
Zfat	A	C	15: 68,180,452	F491V	probably damaging	Het
Zfp623	T	G	15: 75,948,305	V370G	probably damaging	Het

Other mutations in Asxl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01409:Asxl1	APN	2	153392940	splice site	probably benign
IGL01432:Asxl1	APN	2	153400205	missense	probably benign	0.38
IGL01543:Asxl1	APN	2	153401484	missense	probably benign	0.11
IGL02355:Asxl1	APN	2	153401786	missense	probably benign	0.34
IGL02362:Asxl1	APN	2	153401786	missense	probably benign	0.34
IGL02645:Asxl1	APN	2	153392857	missense	possibly damaging	0.94
IGL02696:Asxl1	APN	2	153400195	nonsense	probably null
IGL03365:Asxl1	APN	2	153401754	missense	probably damaging	1.00
IGL03372:Asxl1	APN	2	153400413	missense	probably damaging	0.99
IGL03377:Asxl1	APN	2	153396780	missense	probably damaging	1.00
astrophel	UTSW	2	153400106	missense	possibly damaging	0.75
hairbrush	UTSW	2	153400724	missense	possibly damaging	0.55
R0044:Asxl1	UTSW	2	153400209	missense	probably benign	0.06
R0044:Asxl1	UTSW	2	153400209	missense	probably benign	0.06
R0600:Asxl1	UTSW	2	153399904	missense	probably benign	0.00
R0659:Asxl1	UTSW	2	153400724	missense	possibly damaging	0.55
R0661:Asxl1	UTSW	2	153400724	missense	possibly damaging	0.55
R0684:Asxl1	UTSW	2	153397522	missense	probably damaging	1.00
R1606:Asxl1	UTSW	2	153400455	missense	probably damaging	0.99
R1747:Asxl1	UTSW	2	153393454	missense	possibly damaging	0.86
R1796:Asxl1	UTSW	2	153401606	missense	probably benign	0.31
R1914:Asxl1	UTSW	2	153401906	missense	probably damaging	1.00
R2099:Asxl1	UTSW	2	153352267	missense	possibly damaging	0.95
R2373:Asxl1	UTSW	2	153401900	missense	probably benign	0.13
R2910:Asxl1	UTSW	2	153401039	missense	probably benign	0.00
R3620:Asxl1	UTSW	2	153357155	missense	probably damaging	1.00
R3701:Asxl1	UTSW	2	153399344	missense	probably benign	0.04
R4200:Asxl1	UTSW	2	153400106	missense	possibly damaging	0.75
R4773:Asxl1	UTSW	2	153401985	missense	probably damaging	1.00
R4902:Asxl1	UTSW	2	153399831	missense	probably benign	0.02
R5100:Asxl1	UTSW	2	153397931	missense	probably damaging	1.00
R5102:Asxl1	UTSW	2	153400955	missense	probably benign	0.00
R5166:Asxl1	UTSW	2	153401121	missense	probably damaging	1.00
R5421:Asxl1	UTSW	2	153399584	missense	probably benign	0.04
R5701:Asxl1	UTSW	2	153399489	missense	probably damaging	1.00
R5861:Asxl1	UTSW	2	153399390	missense	probably damaging	0.99
R5973:Asxl1	UTSW	2	153402011	missense	probably damaging	0.97
R6384:Asxl1	UTSW	2	153391824	critical splice donor site	probably null
R7023:Asxl1	UTSW	2	153400549	missense	probably benign	0.00
R7176:Asxl1	UTSW	2	153401988	missense	probably damaging	1.00
R7297:Asxl1	UTSW	2	153397435	missense	probably benign	0.01
R7378:Asxl1	UTSW	2	153401993	missense	probably damaging	1.00
R7464:Asxl1	UTSW	2	153397785	missense	probably benign	0.01
R7678:Asxl1	UTSW	2	153400652	missense	probably damaging	1.00
R7686:Asxl1	UTSW	2	153391614	missense	probably damaging	1.00
R7789:Asxl1	UTSW	2	153400023	missense	probably benign	0.00
R7838:Asxl1	UTSW	2	153396813	missense	probably damaging	1.00
R7898:Asxl1	UTSW	2	153399934	missense	possibly damaging	0.65
R8281:Asxl1	UTSW	2	153399401	missense	probably damaging	1.00
R8354:Asxl1	UTSW	2	153393425	missense	probably benign	0.40
R8383:Asxl1	UTSW	2	153393719	missense	probably damaging	1.00
R8995:Asxl1	UTSW	2	153393966	missense	probably damaging	1.00
R9183:Asxl1	UTSW	2	153397920	missense	probably damaging	0.99
X0024:Asxl1	UTSW	2	153401985	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCATTCCCTCAGAGAGTAGTTCTG -3'
(R):5'- TGGGGCACACTTTCTGTTGC -3'

Sequencing Primer
(F):5'- CCTCAGAGAGTAGTTCTGGACGG -3'
(R):5'- TGCAATGAGAGGAACAGCTCTCTC -3'

Posted On

2019-05-13