Incidental Mutation 'R7028:Kcnd2'
ID 546119
Institutional Source Beutler Lab
Gene Symbol Kcnd2
Ensembl Gene ENSMUSG00000060882
Gene Name potassium voltage-gated channel, Shal-related family, member 2
Synonyms Kv4.2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock # R7028 (G1)
Quality Score 191.009
Status Not validated
Chromosome 6
Chromosomal Location 21215503-21729805 bp(+) (GRCm38)
Type of Mutation start gained
DNA Base Change (assembly) G to A at 21216178 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000080257 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081542]
AlphaFold Q9Z0V2
Predicted Effect probably benign
Transcript: ENSMUST00000081542
SMART Domains Protein: ENSMUSP00000080257
Gene: ENSMUSG00000060882

DomainStartEndE-ValueType
Pfam:Shal-type 3 31 4.5e-16 PFAM
BTB 41 140 3.42e-14 SMART
Pfam:Ion_trans 184 417 1.4e-44 PFAM
Pfam:Ion_trans_2 330 411 5.5e-15 PFAM
low complexity region 418 437 N/A INTRINSIC
Pfam:DUF3399 445 546 5.5e-44 PFAM
low complexity region 594 608 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shal-related subfamily, members of which form voltage-activated A-type potassium ion channels and are prominent in the repolarization phase of the action potential. This member mediates a rapidly inactivating, A-type outward potassium current which is not under the control of the N terminus as it is in Shaker channels. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene reduces A-type currents in spinal cord dorsal horn neurons and increases their excitability, resulting in enhanced sensitivity to tactile and thermal stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A G 2: 69,265,675 I804T probably benign Het
Abcb1b A T 5: 8,805,441 E25V probably damaging Het
Adamts9 G T 6: 92,909,793 Y355* probably null Het
Akp3 A G 1: 87,126,778 M303V probably benign Het
Ankrd35 A T 3: 96,683,334 E312V possibly damaging Het
Arhgap40 T C 2: 158,531,374 probably null Het
Asxl1 T C 2: 153,400,107 L859P probably benign Het
Atat1 A G 17: 35,910,005 F11L probably benign Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Ccdc7a A T 8: 128,881,594 H943Q unknown Het
Cep135 A G 5: 76,616,848 T558A probably benign Het
Cfap99 A G 5: 34,301,519 E86G possibly damaging Het
Cfhr2 C T 1: 139,831,063 probably null Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Col17a1 G A 19: 47,652,183 P992L probably damaging Het
Col7a1 C T 9: 108,963,263 Q1294* probably null Het
Coq8b T A 7: 27,239,868 C148S probably damaging Het
Csmd2 A G 4: 128,277,228 N338S Het
Cspg5 T A 9: 110,246,891 S232T possibly damaging Het
Cyp2c67 A G 19: 39,639,897 V201A possibly damaging Het
Dlgap3 G A 4: 127,195,517 R302H possibly damaging Het
Dpy19l2 T C 9: 24,628,251 I469V probably benign Het
Fam135b T C 15: 71,471,563 D401G probably damaging Het
Gabbr1 G T 17: 37,064,737 G453* probably null Het
Gclc C A 9: 77,788,216 A440D probably damaging Het
Glyat T C 19: 12,650,359 I106T probably benign Het
Gm12185 T C 11: 48,908,244 N474S possibly damaging Het
Gm17079 T C 14: 51,693,037 H117R Het
Gm884 C T 11: 103,614,537 A26T probably benign Het
Ildr2 A G 1: 166,303,529 D318G probably damaging Het
Kif19a C T 11: 114,781,208 T207M probably damaging Het
Kif3a G T 11: 53,586,906 G401* probably null Het
Lactbl1 T A 4: 136,632,975 L155Q probably damaging Het
Lrp1b T A 2: 41,246,011 D1649V probably benign Het
Map2k1 A G 9: 64,193,823 V191A probably benign Het
Mdm4 A T 1: 133,003,809 C165S probably benign Het
Med27 G A 2: 29,509,434 W92* probably null Het
Muc20 A T 16: 32,794,246 S254T probably benign Het
Myh1 A G 11: 67,220,421 E1562G possibly damaging Het
Nlrp2 C G 7: 5,328,572 R275P possibly damaging Het
Notch2 T A 3: 98,102,387 N543K probably damaging Het
Nup214 T A 2: 32,034,156 S1566T probably benign Het
Nxnl1 T G 8: 71,562,793 E157A possibly damaging Het
Obscn A G 11: 59,079,133 L61P probably damaging Het
Ogg1 A T 6: 113,329,276 I145F probably damaging Het
Olfr1359 A G 13: 21,703,270 K90E possibly damaging Het
Olfr453 G A 6: 42,744,403 R122H probably benign Het
Olfr572 T C 7: 102,927,942 F105L probably damaging Het
Olfr976 T C 9: 39,956,345 T197A probably benign Het
Pclo A G 5: 14,713,447 D3978G unknown Het
Pla2g4e T G 2: 120,170,195 D687A probably damaging Het
Pla2r1 T C 2: 60,458,393 K632E probably damaging Het
Plg A T 17: 12,391,836 Q212L probably damaging Het
Poldip3 A T 15: 83,131,497 N306K probably damaging Het
Pspn A G 17: 56,999,978 L13P possibly damaging Het
Ralgapa1 T C 12: 55,758,059 E484G probably damaging Het
Rbmxl1 G T 8: 78,506,657 T19K probably damaging Het
Rora G A 9: 69,196,083 V31I possibly damaging Het
Skint5 C A 4: 113,940,839 W182C probably damaging Het
Spata31d1c A T 13: 65,036,063 Q473L probably damaging Het
Tesk2 G A 4: 116,802,687 W334* probably null Het
Tmem67 C A 4: 12,075,484 V277L probably benign Het
Trhde A G 10: 114,518,177 M537T probably damaging Het
Ttc30a2 A T 2: 75,976,269 L633* probably null Het
Tubb6 G A 18: 67,401,911 M293I probably benign Het
Ube2ql1 A T 13: 69,738,754 L196Q probably damaging Het
Ubn1 A T 16: 5,055,324 N70I probably damaging Het
Ubtf A T 11: 102,314,980 S40T probably benign Het
Virma C T 4: 11,519,249 A782V possibly damaging Het
Xdh G T 17: 73,943,873 T28K probably damaging Het
Xpo4 A G 14: 57,597,051 S691P probably benign Het
Zfat A C 15: 68,180,452 F491V probably damaging Het
Zfp623 T G 15: 75,948,305 V370G probably damaging Het
Other mutations in Kcnd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Kcnd2 APN 6 21714154 missense possibly damaging 0.90
IGL01124:Kcnd2 APN 6 21217217 missense probably damaging 1.00
IGL01317:Kcnd2 APN 6 21727340 makesense probably null
IGL01534:Kcnd2 APN 6 21726145 missense probably benign
IGL02623:Kcnd2 APN 6 21726195 missense probably benign 0.05
IGL02682:Kcnd2 APN 6 21216925 nonsense probably null
IGL02874:Kcnd2 APN 6 21216923 missense probably damaging 1.00
IGL02982:Kcnd2 APN 6 21217149 missense probably damaging 1.00
IGL02983:Kcnd2 APN 6 21216555 missense probably damaging 1.00
IGL03119:Kcnd2 APN 6 21216509 nonsense probably null
IGL03154:Kcnd2 APN 6 21216708 missense probably damaging 1.00
IGL03174:Kcnd2 APN 6 21216516 missense possibly damaging 0.93
IGL03296:Kcnd2 APN 6 21714209 missense probably damaging 1.00
R0062:Kcnd2 UTSW 6 21727226 missense possibly damaging 0.80
R0062:Kcnd2 UTSW 6 21727226 missense possibly damaging 0.80
R0325:Kcnd2 UTSW 6 21216683 missense probably damaging 0.99
R0771:Kcnd2 UTSW 6 21216442 missense probably damaging 1.00
R0836:Kcnd2 UTSW 6 21726239 splice site probably benign
R0836:Kcnd2 UTSW 6 21727329 missense probably damaging 1.00
R0884:Kcnd2 UTSW 6 21216541 missense probably benign
R1434:Kcnd2 UTSW 6 21216357 missense probably damaging 1.00
R2116:Kcnd2 UTSW 6 21216432 missense probably damaging 1.00
R3863:Kcnd2 UTSW 6 21217263 nonsense probably null
R3939:Kcnd2 UTSW 6 21217096 missense probably damaging 1.00
R4427:Kcnd2 UTSW 6 21216897 missense probably damaging 0.99
R4561:Kcnd2 UTSW 6 21216396 missense probably benign
R4707:Kcnd2 UTSW 6 21723212 missense probably benign
R5523:Kcnd2 UTSW 6 21723212 missense probably benign
R5545:Kcnd2 UTSW 6 21217019 missense probably damaging 1.00
R5926:Kcnd2 UTSW 6 21217085 missense probably damaging 0.99
R6900:Kcnd2 UTSW 6 21216588 missense probably damaging 1.00
R7010:Kcnd2 UTSW 6 21216708 missense probably damaging 1.00
R7183:Kcnd2 UTSW 6 21216437 missense probably damaging 1.00
R7387:Kcnd2 UTSW 6 21216778 missense probably benign 0.28
R7463:Kcnd2 UTSW 6 21216498 missense probably damaging 1.00
R8007:Kcnd2 UTSW 6 21217074 missense probably damaging 0.99
R8305:Kcnd2 UTSW 6 21726198 nonsense probably null
R8465:Kcnd2 UTSW 6 21216696 missense probably damaging 1.00
R9329:Kcnd2 UTSW 6 21725982 missense probably damaging 1.00
X0021:Kcnd2 UTSW 6 21217323 missense probably damaging 0.99
Z1177:Kcnd2 UTSW 6 21216416 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGTTTACATGTGCCAGGAC -3'
(R):5'- TATCAGAGCGTCCTGAGTCC -3'

Sequencing Primer
(F):5'- TTACATGTGCCAGGACCTGCC -3'
(R):5'- TAGGCCCCGAAGCAACAGG -3'
Posted On 2019-05-13