Incidental Mutation 'R7028:Olfr453'
ID546120
Institutional Source Beutler Lab
Gene Symbol Olfr453
Ensembl Gene ENSMUSG00000095831
Gene Nameolfactory receptor 453
SynonymsMOR257-8P, GA_x6K02T2P3E9-4815856-4814903
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R7028 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location42739371-42746963 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 42744403 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 122 (R122H)
Ref Sequence ENSEMBL: ENSMUSP00000150467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053647] [ENSMUST00000213997]
Predicted Effect probably benign
Transcript: ENSMUST00000053647
AA Change: R122H

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000052043
Gene: ENSMUSG00000095831
AA Change: R122H

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.6e-54 PFAM
Pfam:7tm_1 41 290 1.8e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213997
AA Change: R122H

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A G 2: 69,265,675 I804T probably benign Het
Abcb1b A T 5: 8,805,441 E25V probably damaging Het
Adamts9 G T 6: 92,909,793 Y355* probably null Het
Akp3 A G 1: 87,126,778 M303V probably benign Het
Ankrd35 A T 3: 96,683,334 E312V possibly damaging Het
Arhgap40 T C 2: 158,531,374 probably null Het
Asxl1 T C 2: 153,400,107 L859P probably benign Het
Atat1 A G 17: 35,910,005 F11L probably benign Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Ccdc7a A T 8: 128,881,594 H943Q unknown Het
Cep135 A G 5: 76,616,848 T558A probably benign Het
Cfap99 A G 5: 34,301,519 E86G possibly damaging Het
Cfhr2 C T 1: 139,831,063 probably null Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Col17a1 G A 19: 47,652,183 P992L probably damaging Het
Col7a1 C T 9: 108,963,263 Q1294* probably null Het
Coq8b T A 7: 27,239,868 C148S probably damaging Het
Csmd2 A G 4: 128,277,228 N338S Het
Cspg5 T A 9: 110,246,891 S232T possibly damaging Het
Cyp2c67 A G 19: 39,639,897 V201A possibly damaging Het
Dlgap3 G A 4: 127,195,517 R302H possibly damaging Het
Dpy19l2 T C 9: 24,628,251 I469V probably benign Het
Fam135b T C 15: 71,471,563 D401G probably damaging Het
Gabbr1 G T 17: 37,064,737 G453* probably null Het
Gclc C A 9: 77,788,216 A440D probably damaging Het
Glyat T C 19: 12,650,359 I106T probably benign Het
Gm12185 T C 11: 48,908,244 N474S possibly damaging Het
Gm17079 T C 14: 51,693,037 H117R Het
Gm884 C T 11: 103,614,537 A26T probably benign Het
Ildr2 A G 1: 166,303,529 D318G probably damaging Het
Kcnd2 G A 6: 21,216,178 probably benign Het
Kif19a C T 11: 114,781,208 T207M probably damaging Het
Kif3a G T 11: 53,586,906 G401* probably null Het
Lactbl1 T A 4: 136,632,975 L155Q probably damaging Het
Lrp1b T A 2: 41,246,011 D1649V probably benign Het
Map2k1 A G 9: 64,193,823 V191A probably benign Het
Mdm4 A T 1: 133,003,809 C165S probably benign Het
Med27 G A 2: 29,509,434 W92* probably null Het
Muc20 A T 16: 32,794,246 S254T probably benign Het
Myh1 A G 11: 67,220,421 E1562G possibly damaging Het
Nlrp2 C G 7: 5,328,572 R275P possibly damaging Het
Notch2 T A 3: 98,102,387 N543K probably damaging Het
Nup214 T A 2: 32,034,156 S1566T probably benign Het
Nxnl1 T G 8: 71,562,793 E157A possibly damaging Het
Obscn A G 11: 59,079,133 L61P probably damaging Het
Ogg1 A T 6: 113,329,276 I145F probably damaging Het
Olfr1359 A G 13: 21,703,270 K90E possibly damaging Het
Olfr572 T C 7: 102,927,942 F105L probably damaging Het
Olfr976 T C 9: 39,956,345 T197A probably benign Het
Pclo A G 5: 14,713,447 D3978G unknown Het
Pla2g4e T G 2: 120,170,195 D687A probably damaging Het
Pla2r1 T C 2: 60,458,393 K632E probably damaging Het
Plg A T 17: 12,391,836 Q212L probably damaging Het
Poldip3 A T 15: 83,131,497 N306K probably damaging Het
Pspn A G 17: 56,999,978 L13P possibly damaging Het
Ralgapa1 T C 12: 55,758,059 E484G probably damaging Het
Rbmxl1 G T 8: 78,506,657 T19K probably damaging Het
Rora G A 9: 69,196,083 V31I possibly damaging Het
Skint5 C A 4: 113,940,839 W182C probably damaging Het
Spata31d1c A T 13: 65,036,063 Q473L probably damaging Het
Tesk2 G A 4: 116,802,687 W334* probably null Het
Tmem67 C A 4: 12,075,484 V277L probably benign Het
Trhde A G 10: 114,518,177 M537T probably damaging Het
Ttc30a2 A T 2: 75,976,269 L633* probably null Het
Tubb6 G A 18: 67,401,911 M293I probably benign Het
Ube2ql1 A T 13: 69,738,754 L196Q probably damaging Het
Ubn1 A T 16: 5,055,324 N70I probably damaging Het
Ubtf A T 11: 102,314,980 S40T probably benign Het
Virma C T 4: 11,519,249 A782V possibly damaging Het
Xdh G T 17: 73,943,873 T28K probably damaging Het
Xpo4 A G 14: 57,597,051 S691P probably benign Het
Zfat A C 15: 68,180,452 F491V probably damaging Het
Zfp623 T G 15: 75,948,305 V370G probably damaging Het
Other mutations in Olfr453
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00934:Olfr453 APN 6 42744691 missense probably damaging 1.00
IGL01642:Olfr453 APN 6 42744552 missense probably benign 0.00
IGL02703:Olfr453 APN 6 42744076 missense possibly damaging 0.90
IGL03018:Olfr453 APN 6 42744814 missense probably damaging 1.00
R1163:Olfr453 UTSW 6 42744123 missense probably benign 0.00
R1728:Olfr453 UTSW 6 42744135 missense possibly damaging 0.61
R1729:Olfr453 UTSW 6 42744135 missense possibly damaging 0.61
R1730:Olfr453 UTSW 6 42744135 missense possibly damaging 0.61
R1739:Olfr453 UTSW 6 42744135 missense possibly damaging 0.61
R1784:Olfr453 UTSW 6 42744135 missense possibly damaging 0.61
R2014:Olfr453 UTSW 6 42744850 missense probably damaging 0.99
R2015:Olfr453 UTSW 6 42744850 missense probably damaging 0.99
R2130:Olfr453 UTSW 6 42744135 missense possibly damaging 0.61
R2132:Olfr453 UTSW 6 42744135 missense possibly damaging 0.61
R2133:Olfr453 UTSW 6 42744135 missense possibly damaging 0.61
R3937:Olfr453 UTSW 6 42744076 missense probably damaging 0.98
R4862:Olfr453 UTSW 6 42744555 missense possibly damaging 0.65
R4959:Olfr453 UTSW 6 42744687 missense probably damaging 1.00
R4973:Olfr453 UTSW 6 42744687 missense probably damaging 1.00
R5155:Olfr453 UTSW 6 42744814 missense probably damaging 1.00
R6581:Olfr453 UTSW 6 42744079 missense probably damaging 1.00
R7348:Olfr453 UTSW 6 42744856 missense possibly damaging 0.95
R7490:Olfr453 UTSW 6 42744805 missense probably damaging 1.00
R7522:Olfr453 UTSW 6 42744634 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCAGACTGGACAGCAGACTC -3'
(R):5'- AGCAGCTCGCAGGATATATGG -3'

Sequencing Primer
(F):5'- TGGACAGCAGACTCCACACTC -3'
(R):5'- CGCAGGATATATGGTCTATGTACACG -3'
Posted On2019-05-13