Mutagenetix > Incidental Mutation

Incidental Mutation 'R7028:Adamts9'

546121

Institutional Source

Beutler Lab

Gene Symbol

Adamts9

Ensembl Gene

ENSMUSG00000030022

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 9

Synonyms

8430403M15Rik, E030027K14Rik, 1810011L16Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7028 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

92772699-92943492 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 92909793 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 355 (Y355*)

Ref Sequence

ENSEMBL: ENSMUSP00000109065 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113438]

AlphaFold

E9PUN6

Predicted Effect

probably null
Transcript: ENSMUST00000113438
AA Change: Y355*

SMART Domains

Protein: ENSMUSP00000109065
Gene: ENSMUSG00000030022
AA Change: Y355*

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:Pep_M12B_propep	49	207	1.8e-37	PFAM
low complexity region	234	247	N/A	INTRINSIC
Pfam:Reprolysin_5	291	476	7.6e-17	PFAM
Pfam:Reprolysin_4	291	495	2e-11	PFAM
Pfam:Reprolysin	293	499	7.4e-29	PFAM
Pfam:Reprolysin_2	310	489	1e-13	PFAM
Pfam:Reprolysin_3	314	445	1.7e-14	PFAM
TSP1	591	643	2.15e-9	SMART
Pfam:ADAM_spacer1	753	871	7.3e-35	PFAM
TSP1	881	936	1.14e0	SMART
Blast:TSP1	938	993	2e-28	BLAST
TSP1	1000	1054	3.78e-5	SMART
TSP1	1055	1109	5.64e-4	SMART
TSP1	1110	1166	1.25e-5	SMART
TSP1	1186	1240	1.45e-6	SMART
TSP1	1242	1296	4.41e-6	SMART
TSP1	1328	1380	7.06e-5	SMART
TSP1	1381	1436	4.24e-8	SMART
TSP1	1440	1495	8.23e-6	SMART
TSP1	1496	1551	1.23e-4	SMART
TSP1	1552	1609	2e-4	SMART
TSP1	1611	1672	1.25e-5	SMART
TSP1	1676	1730	3.47e-4	SMART
Pfam:GON	1732	1930	1.6e-85	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. Members of the ADAMTS family have been implicated in the cleavage of proteoglycans, the control of organ shape during development, and the inhibition of angiogenesis. This gene is localized to chromosome 3p14.3-p14.2, an area known to be lost in hereditary renal tumors. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	A	G	2: 69,265,675	I804T	probably benign	Het
Abcb1b	A	T	5: 8,805,441	E25V	probably damaging	Het
Akp3	A	G	1: 87,126,778	M303V	probably benign	Het
Ankrd35	A	T	3: 96,683,334	E312V	possibly damaging	Het
Arhgap40	T	C	2: 158,531,374		probably null	Het
Asxl1	T	C	2: 153,400,107	L859P	probably benign	Het
Atat1	A	G	17: 35,910,005	F11L	probably benign	Het
Bach1	G	A	16: 87,719,291	R240Q	probably benign	Het
Ccdc7a	A	T	8: 128,881,594	H943Q	unknown	Het
Cep135	A	G	5: 76,616,848	T558A	probably benign	Het
Cfap99	A	G	5: 34,301,519	E86G	possibly damaging	Het
Cfhr2	C	T	1: 139,831,063		probably null	Het
Cmtm1	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	8: 104,309,470		probably benign	Het
Col17a1	G	A	19: 47,652,183	P992L	probably damaging	Het
Col7a1	C	T	9: 108,963,263	Q1294*	probably null	Het
Coq8b	T	A	7: 27,239,868	C148S	probably damaging	Het
Csmd2	A	G	4: 128,277,228	N338S		Het
Cspg5	T	A	9: 110,246,891	S232T	possibly damaging	Het
Cyp2c67	A	G	19: 39,639,897	V201A	possibly damaging	Het
Dlgap3	G	A	4: 127,195,517	R302H	possibly damaging	Het
Dpy19l2	T	C	9: 24,628,251	I469V	probably benign	Het
Fam135b	T	C	15: 71,471,563	D401G	probably damaging	Het
Gabbr1	G	T	17: 37,064,737	G453*	probably null	Het
Gclc	C	A	9: 77,788,216	A440D	probably damaging	Het
Glyat	T	C	19: 12,650,359	I106T	probably benign	Het
Gm12185	T	C	11: 48,908,244	N474S	possibly damaging	Het
Gm17079	T	C	14: 51,693,037	H117R		Het
Gm884	C	T	11: 103,614,537	A26T	probably benign	Het
Ildr2	A	G	1: 166,303,529	D318G	probably damaging	Het
Kcnd2	G	A	6: 21,216,178		probably benign	Het
Kif19a	C	T	11: 114,781,208	T207M	probably damaging	Het
Kif3a	G	T	11: 53,586,906	G401*	probably null	Het
Lactbl1	T	A	4: 136,632,975	L155Q	probably damaging	Het
Lrp1b	T	A	2: 41,246,011	D1649V	probably benign	Het
Map2k1	A	G	9: 64,193,823	V191A	probably benign	Het
Mdm4	A	T	1: 133,003,809	C165S	probably benign	Het
Med27	G	A	2: 29,509,434	W92*	probably null	Het
Muc20	A	T	16: 32,794,246	S254T	probably benign	Het
Myh1	A	G	11: 67,220,421	E1562G	possibly damaging	Het
Nlrp2	C	G	7: 5,328,572	R275P	possibly damaging	Het
Notch2	T	A	3: 98,102,387	N543K	probably damaging	Het
Nup214	T	A	2: 32,034,156	S1566T	probably benign	Het
Nxnl1	T	G	8: 71,562,793	E157A	possibly damaging	Het
Obscn	A	G	11: 59,079,133	L61P	probably damaging	Het
Ogg1	A	T	6: 113,329,276	I145F	probably damaging	Het
Olfr1359	A	G	13: 21,703,270	K90E	possibly damaging	Het
Olfr453	G	A	6: 42,744,403	R122H	probably benign	Het
Olfr572	T	C	7: 102,927,942	F105L	probably damaging	Het
Olfr976	T	C	9: 39,956,345	T197A	probably benign	Het
Pclo	A	G	5: 14,713,447	D3978G	unknown	Het
Pla2g4e	T	G	2: 120,170,195	D687A	probably damaging	Het
Pla2r1	T	C	2: 60,458,393	K632E	probably damaging	Het
Plg	A	T	17: 12,391,836	Q212L	probably damaging	Het
Poldip3	A	T	15: 83,131,497	N306K	probably damaging	Het
Pspn	A	G	17: 56,999,978	L13P	possibly damaging	Het
Ralgapa1	T	C	12: 55,758,059	E484G	probably damaging	Het
Rbmxl1	G	T	8: 78,506,657	T19K	probably damaging	Het
Rora	G	A	9: 69,196,083	V31I	possibly damaging	Het
Skint5	C	A	4: 113,940,839	W182C	probably damaging	Het
Spata31d1c	A	T	13: 65,036,063	Q473L	probably damaging	Het
Tesk2	G	A	4: 116,802,687	W334*	probably null	Het
Tmem67	C	A	4: 12,075,484	V277L	probably benign	Het
Trhde	A	G	10: 114,518,177	M537T	probably damaging	Het
Ttc30a2	A	T	2: 75,976,269	L633*	probably null	Het
Tubb6	G	A	18: 67,401,911	M293I	probably benign	Het
Ube2ql1	A	T	13: 69,738,754	L196Q	probably damaging	Het
Ubn1	A	T	16: 5,055,324	N70I	probably damaging	Het
Ubtf	A	T	11: 102,314,980	S40T	probably benign	Het
Virma	C	T	4: 11,519,249	A782V	possibly damaging	Het
Xdh	G	T	17: 73,943,873	T28K	probably damaging	Het
Xpo4	A	G	14: 57,597,051	S691P	probably benign	Het
Zfat	A	C	15: 68,180,452	F491V	probably damaging	Het
Zfp623	T	G	15: 75,948,305	V370G	probably damaging	Het

Other mutations in Adamts9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00565:Adamts9	APN	6	92859902	missense	possibly damaging	0.90
IGL01352:Adamts9	APN	6	92860174	missense	probably benign	0.00
IGL01462:Adamts9	APN	6	92894266	missense	probably benign	0.04
IGL01551:Adamts9	APN	6	92807020	missense	probably damaging	0.99
IGL01577:Adamts9	APN	6	92858147	splice site	probably benign
IGL01638:Adamts9	APN	6	92872428	missense	probably benign	0.19
IGL01757:Adamts9	APN	6	92796159	missense	probably damaging	1.00
IGL02102:Adamts9	APN	6	92777439	missense	probably benign	0.00
IGL02379:Adamts9	APN	6	92797033	missense	probably damaging	0.97
IGL02419:Adamts9	APN	6	92796997	missense	probably benign	0.04
IGL02554:Adamts9	APN	6	92880847	missense	probably benign	0.01
IGL02832:Adamts9	APN	6	92807175	missense	probably damaging	1.00
IGL03164:Adamts9	APN	6	92889937	missense	probably damaging	1.00
IGL03347:Adamts9	APN	6	92887432	nonsense	probably null
IGL03401:Adamts9	APN	6	92786868	missense	probably damaging	0.97
basilisk	UTSW	6	92860189	missense	probably benign	0.35
bluebeard	UTSW	6	92879959	nonsense	probably null
Serpent	UTSW	6	92908706	missense	probably damaging	1.00
PIT4402001:Adamts9	UTSW	6	92872347	missense	probably benign
PIT4458001:Adamts9	UTSW	6	92889905	missense	probably damaging	0.99
R0047:Adamts9	UTSW	6	92905306	unclassified	probably benign
R0047:Adamts9	UTSW	6	92905306	unclassified	probably benign
R0067:Adamts9	UTSW	6	92890167	missense	probably damaging	0.98
R0141:Adamts9	UTSW	6	92943085	missense	probably benign
R0326:Adamts9	UTSW	6	92858057	nonsense	probably null
R0396:Adamts9	UTSW	6	92798005	missense	probably benign	0.00
R0490:Adamts9	UTSW	6	92872866	missense	probably benign
R0504:Adamts9	UTSW	6	92912645	missense	probably damaging	1.00
R0620:Adamts9	UTSW	6	92858113	missense	possibly damaging	0.95
R0669:Adamts9	UTSW	6	92880957	missense	probably damaging	1.00
R0682:Adamts9	UTSW	6	92903802	missense	possibly damaging	0.80
R1412:Adamts9	UTSW	6	92796433	missense	probably benign
R1433:Adamts9	UTSW	6	92849290	critical splice donor site	probably null
R1558:Adamts9	UTSW	6	92908711	missense	possibly damaging	0.87
R1661:Adamts9	UTSW	6	92880623	missense	possibly damaging	0.92
R1801:Adamts9	UTSW	6	92863376	missense	probably benign	0.27
R1855:Adamts9	UTSW	6	92901369	splice site	probably benign
R1887:Adamts9	UTSW	6	92872788	critical splice donor site	probably null
R1934:Adamts9	UTSW	6	92943121	missense	possibly damaging	0.59
R1956:Adamts9	UTSW	6	92859849	missense	probably damaging	1.00
R1986:Adamts9	UTSW	6	92796394	missense	probably benign
R2370:Adamts9	UTSW	6	92860203	missense	probably damaging	0.99
R2376:Adamts9	UTSW	6	92912831	missense	probably benign
R2432:Adamts9	UTSW	6	92857900	missense	probably damaging	1.00
R2876:Adamts9	UTSW	6	92795910	splice site	probably benign
R3015:Adamts9	UTSW	6	92872932	missense	probably benign	0.05
R3611:Adamts9	UTSW	6	92869984	missense	probably benign	0.05
R4024:Adamts9	UTSW	6	92872784	splice site	probably benign
R4292:Adamts9	UTSW	6	92795996	missense	possibly damaging	0.95
R4403:Adamts9	UTSW	6	92859864	missense	probably damaging	1.00
R4574:Adamts9	UTSW	6	92879959	nonsense	probably null
R4677:Adamts9	UTSW	6	92816606	start codon destroyed	probably null
R5114:Adamts9	UTSW	6	92890273	missense	probably benign	0.03
R5260:Adamts9	UTSW	6	92807137	missense	probably benign	0.00
R5384:Adamts9	UTSW	6	92798018	missense	probably damaging	1.00
R5423:Adamts9	UTSW	6	92880697	missense	possibly damaging	0.84
R5497:Adamts9	UTSW	6	92854365	missense	probably damaging	1.00
R5629:Adamts9	UTSW	6	92798133	missense	probably damaging	1.00
R5943:Adamts9	UTSW	6	92903786	missense	probably benign	0.02
R6039:Adamts9	UTSW	6	92908546	missense	possibly damaging	0.95
R6039:Adamts9	UTSW	6	92908546	missense	possibly damaging	0.95
R6051:Adamts9	UTSW	6	92859926	missense	possibly damaging	0.83
R6051:Adamts9	UTSW	6	92890118	missense	probably damaging	1.00
R6082:Adamts9	UTSW	6	92889949	missense	probably damaging	1.00
R6192:Adamts9	UTSW	6	92797021	missense	probably damaging	1.00
R6291:Adamts9	UTSW	6	92890120	missense	probably damaging	1.00
R6502:Adamts9	UTSW	6	92872335	missense	probably damaging	1.00
R6818:Adamts9	UTSW	6	92905191	missense	probably damaging	1.00
R6848:Adamts9	UTSW	6	92863354	missense	possibly damaging	0.84
R7095:Adamts9	UTSW	6	92887691	missense	probably benign	0.39
R7287:Adamts9	UTSW	6	92890003	missense	possibly damaging	0.89
R7294:Adamts9	UTSW	6	92894289	missense	probably damaging	1.00
R7313:Adamts9	UTSW	6	92858121	missense	probably damaging	1.00
R7581:Adamts9	UTSW	6	92937338	missense	probably benign	0.00
R7682:Adamts9	UTSW	6	92880698	missense	possibly damaging	0.57
R7691:Adamts9	UTSW	6	92796238	missense	probably damaging	1.00
R7791:Adamts9	UTSW	6	92872385	missense	probably benign	0.00
R7851:Adamts9	UTSW	6	92908706	missense	probably damaging	1.00
R7974:Adamts9	UTSW	6	92909687	critical splice donor site	probably null
R8224:Adamts9	UTSW	6	92796370	missense	probably damaging	0.96
R8328:Adamts9	UTSW	6	92890012	missense	probably benign	0.17
R8334:Adamts9	UTSW	6	92937244	splice site	probably null
R8559:Adamts9	UTSW	6	92807136	missense	probably benign	0.01
R8709:Adamts9	UTSW	6	92807163	missense	probably damaging	1.00
R8735:Adamts9	UTSW	6	92860067	intron	probably benign
R8739:Adamts9	UTSW	6	92854280	missense	probably benign	0.04
R9108:Adamts9	UTSW	6	92880740	missense	probably damaging	1.00
R9171:Adamts9	UTSW	6	92872400	missense	probably benign	0.03
R9198:Adamts9	UTSW	6	92860189	missense	probably benign	0.35
R9299:Adamts9	UTSW	6	92796995	missense	probably benign	0.00
R9300:Adamts9	UTSW	6	92887390	missense	probably benign	0.10
R9308:Adamts9	UTSW	6	92880894	missense	probably benign	0.03
R9325:Adamts9	UTSW	6	92872298	missense	probably benign	0.00
R9397:Adamts9	UTSW	6	92901463	missense	probably damaging	1.00
R9550:Adamts9	UTSW	6	92901448	missense	probably benign	0.00
R9623:Adamts9	UTSW	6	92880680	missense	probably benign	0.02
R9698:Adamts9	UTSW	6	92807140	missense	probably damaging	1.00
R9755:Adamts9	UTSW	6	92879941	missense	probably benign	0.15
RF013:Adamts9	UTSW	6	92943145	missense	possibly damaging	0.88
Z1177:Adamts9	UTSW	6	92854346	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ATGCAGGACCCCTCCCATTG -3'
(R):5'- TGTTTACACAGAGAGTCCGC -3'

Sequencing Primer
(F):5'- TTGCTGACACCAAGGATCCGAG -3'
(R):5'- CAGAGAGTCCGCCATTAACTTTG -3'

Posted On

2019-05-13