Mutagenetix > Incidental Mutations

Incidental Mutation 'R7028:Nlrp2'

546123

Institutional Source

Beutler Lab

Gene Symbol

Nlrp2

Ensembl Gene

ENSMUSG00000035177

Gene Name

NLR family, pyrin domain containing 2

Synonyms

Nbs1, Pan1, PYPAF2, E330007A02Rik, Nalp2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7028 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

5298547-5351035 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 5328572 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Proline at position 275 (R275P)

Ref Sequence

ENSEMBL: ENSMUSP00000045077 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045022]

AlphaFold

Q4PLS0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000045022
AA Change: R275P

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000045077
Gene: ENSMUSG00000035177
AA Change: R275P

Domain	Start	End	E-Value	Type
PYRIN	7	90	2.88e-17	SMART
Pfam:NACHT	180	348	6.9e-30	PFAM
internal_repeat_1	676	722	1.74e-5	PROSPERO
LRR	796	823	1.26e1	SMART
LRR	825	852	1.18e1	SMART
LRR	853	880	5.81e-2	SMART
LRR	882	909	3.39e-3	SMART
LRR	910	937	5.06e-2	SMART
LRR	939	966	5.23e0	SMART
LRR	967	994	3.58e-2	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the nucleotide-binding and leucine-rich repeat receptor (NLR) family, and is predicted to contain an N-terminal pyrin effector domain (PYD), a centrally-located nucleotide-binding and oligomerization domain (NACHT) and C-terminal leucine-rich repeats (LRR). Members of this gene family are thought to be important regulators of immune responses. This gene product interacts with components of the IkB kinase (IKK) complex, and can regulate both caspase-1 and NF-kB (nuclear factor kappa-light-chain-enhancer of activated B cells) activity. The pyrin domain is necessary and sufficient for suppression of NF-kB activity. An allelic variant (rs147585490) has been found that is incapable of blocking the transcriptional activity of NF-kB. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	A	G	2: 69,265,675	I804T	probably benign	Het
Abcb1b	A	T	5: 8,805,441	E25V	probably damaging	Het
Adamts9	G	T	6: 92,909,793	Y355*	probably null	Het
Akp3	A	G	1: 87,126,778	M303V	probably benign	Het
Ankrd35	A	T	3: 96,683,334	E312V	possibly damaging	Het
Arhgap40	T	C	2: 158,531,374		probably null	Het
Asxl1	T	C	2: 153,400,107	L859P	probably benign	Het
Atat1	A	G	17: 35,910,005	F11L	probably benign	Het
Bach1	G	A	16: 87,719,291	R240Q	probably benign	Het
Ccdc7a	A	T	8: 128,881,594	H943Q	unknown	Het
Cep135	A	G	5: 76,616,848	T558A	probably benign	Het
Cfap99	A	G	5: 34,301,519	E86G	possibly damaging	Het
Cfhr2	C	T	1: 139,831,063		probably null	Het
Cmtm1	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	8: 104,309,470		probably benign	Het
Col17a1	G	A	19: 47,652,183	P992L	probably damaging	Het
Col7a1	C	T	9: 108,963,263	Q1294*	probably null	Het
Coq8b	T	A	7: 27,239,868	C148S	probably damaging	Het
Csmd2	A	G	4: 128,277,228	N338S		Het
Cspg5	T	A	9: 110,246,891	S232T	possibly damaging	Het
Cyp2c67	A	G	19: 39,639,897	V201A	possibly damaging	Het
Dlgap3	G	A	4: 127,195,517	R302H	possibly damaging	Het
Dpy19l2	T	C	9: 24,628,251	I469V	probably benign	Het
Fam135b	T	C	15: 71,471,563	D401G	probably damaging	Het
Gabbr1	G	T	17: 37,064,737	G453*	probably null	Het
Gclc	C	A	9: 77,788,216	A440D	probably damaging	Het
Glyat	T	C	19: 12,650,359	I106T	probably benign	Het
Gm12185	T	C	11: 48,908,244	N474S	possibly damaging	Het
Gm17079	T	C	14: 51,693,037	H117R		Het
Gm884	C	T	11: 103,614,537	A26T	probably benign	Het
Ildr2	A	G	1: 166,303,529	D318G	probably damaging	Het
Kcnd2	G	A	6: 21,216,178		probably benign	Het
Kif19a	C	T	11: 114,781,208	T207M	probably damaging	Het
Kif3a	G	T	11: 53,586,906	G401*	probably null	Het
Lactbl1	T	A	4: 136,632,975	L155Q	probably damaging	Het
Lrp1b	T	A	2: 41,246,011	D1649V	probably benign	Het
Map2k1	A	G	9: 64,193,823	V191A	probably benign	Het
Mdm4	A	T	1: 133,003,809	C165S	probably benign	Het
Med27	G	A	2: 29,509,434	W92*	probably null	Het
Muc20	A	T	16: 32,794,246	S254T	probably benign	Het
Myh1	A	G	11: 67,220,421	E1562G	possibly damaging	Het
Notch2	T	A	3: 98,102,387	N543K	probably damaging	Het
Nup214	T	A	2: 32,034,156	S1566T	probably benign	Het
Nxnl1	T	G	8: 71,562,793	E157A	possibly damaging	Het
Obscn	A	G	11: 59,079,133	L61P	probably damaging	Het
Ogg1	A	T	6: 113,329,276	I145F	probably damaging	Het
Olfr1359	A	G	13: 21,703,270	K90E	possibly damaging	Het
Olfr453	G	A	6: 42,744,403	R122H	probably benign	Het
Olfr572	T	C	7: 102,927,942	F105L	probably damaging	Het
Olfr976	T	C	9: 39,956,345	T197A	probably benign	Het
Pclo	A	G	5: 14,713,447	D3978G	unknown	Het
Pla2g4e	T	G	2: 120,170,195	D687A	probably damaging	Het
Pla2r1	T	C	2: 60,458,393	K632E	probably damaging	Het
Plg	A	T	17: 12,391,836	Q212L	probably damaging	Het
Poldip3	A	T	15: 83,131,497	N306K	probably damaging	Het
Pspn	A	G	17: 56,999,978	L13P	possibly damaging	Het
Ralgapa1	T	C	12: 55,758,059	E484G	probably damaging	Het
Rbmxl1	G	T	8: 78,506,657	T19K	probably damaging	Het
Rora	G	A	9: 69,196,083	V31I	possibly damaging	Het
Skint5	C	A	4: 113,940,839	W182C	probably damaging	Het
Spata31d1c	A	T	13: 65,036,063	Q473L	probably damaging	Het
Tesk2	G	A	4: 116,802,687	W334*	probably null	Het
Tmem67	C	A	4: 12,075,484	V277L	probably benign	Het
Trhde	A	G	10: 114,518,177	M537T	probably damaging	Het
Ttc30a2	A	T	2: 75,976,269	L633*	probably null	Het
Tubb6	G	A	18: 67,401,911	M293I	probably benign	Het
Ube2ql1	A	T	13: 69,738,754	L196Q	probably damaging	Het
Ubn1	A	T	16: 5,055,324	N70I	probably damaging	Het
Ubtf	A	T	11: 102,314,980	S40T	probably benign	Het
Virma	C	T	4: 11,519,249	A782V	possibly damaging	Het
Xdh	G	T	17: 73,943,873	T28K	probably damaging	Het
Xpo4	A	G	14: 57,597,051	S691P	probably benign	Het
Zfat	A	C	15: 68,180,452	F491V	probably damaging	Het
Zfp623	T	G	15: 75,948,305	V370G	probably damaging	Het

Other mutations in Nlrp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00485:Nlrp2	APN	7	5337548	missense	probably benign	0.00
IGL00545:Nlrp2	APN	7	5328252	missense	possibly damaging	0.89
IGL01311:Nlrp2	APN	7	5319239	missense	possibly damaging	0.92
IGL01345:Nlrp2	APN	7	5317492	missense	probably benign	0.16
IGL01583:Nlrp2	APN	7	5337770	missense	probably damaging	1.00
IGL01659:Nlrp2	APN	7	5328035	missense	probably damaging	1.00
IGL02240:Nlrp2	APN	7	5327823	missense	probably damaging	1.00
IGL02353:Nlrp2	APN	7	5337599	missense	probably damaging	1.00
IGL02360:Nlrp2	APN	7	5337599	missense	probably damaging	1.00
IGL02399:Nlrp2	APN	7	5328810	missense	probably damaging	1.00
IGL02441:Nlrp2	APN	7	5335567	critical splice donor site	probably null
IGL02588:Nlrp2	APN	7	5327552	nonsense	probably null
IGL02803:Nlrp2	APN	7	5328318	missense	probably damaging	1.00
IGL02968:Nlrp2	APN	7	5301025	missense	possibly damaging	0.81
IGL03342:Nlrp2	APN	7	5317483	missense	probably damaging	1.00
BB006:Nlrp2	UTSW	7	5327499	missense	probably damaging	1.00
BB016:Nlrp2	UTSW	7	5327499	missense	probably damaging	1.00
R0027:Nlrp2	UTSW	7	5322448	missense	probably damaging	1.00
R0051:Nlrp2	UTSW	7	5322334	unclassified	probably benign
R0079:Nlrp2	UTSW	7	5327730	missense	possibly damaging	0.81
R0130:Nlrp2	UTSW	7	5322418	missense	possibly damaging	0.77
R0157:Nlrp2	UTSW	7	5308770	missense	possibly damaging	0.88
R0201:Nlrp2	UTSW	7	5328329	missense	probably benign	0.00
R0276:Nlrp2	UTSW	7	5328109	missense	probably benign	0.00
R0288:Nlrp2	UTSW	7	5328545	missense	probably benign	0.19
R0332:Nlrp2	UTSW	7	5317630	missense	probably damaging	1.00
R0724:Nlrp2	UTSW	7	5319222	missense	probably damaging	1.00
R1241:Nlrp2	UTSW	7	5328431	missense	probably damaging	1.00
R1355:Nlrp2	UTSW	7	5327491	missense	possibly damaging	0.81
R1392:Nlrp2	UTSW	7	5329015	splice site	probably benign
R1470:Nlrp2	UTSW	7	5300951	missense	probably benign	0.18
R1470:Nlrp2	UTSW	7	5300951	missense	probably benign	0.18
R1563:Nlrp2	UTSW	7	5308725	missense	probably damaging	1.00
R1866:Nlrp2	UTSW	7	5327716	nonsense	probably null
R1942:Nlrp2	UTSW	7	5322448	missense	probably damaging	1.00
R1959:Nlrp2	UTSW	7	5327738	missense	probably damaging	1.00
R1960:Nlrp2	UTSW	7	5327738	missense	probably damaging	1.00
R1961:Nlrp2	UTSW	7	5327738	missense	probably damaging	1.00
R2072:Nlrp2	UTSW	7	5325006	missense	probably damaging	1.00
R2161:Nlrp2	UTSW	7	5325042	missense	probably damaging	1.00
R2190:Nlrp2	UTSW	7	5319238	missense	possibly damaging	0.95
R2243:Nlrp2	UTSW	7	5335598	missense	probably benign	0.03
R2277:Nlrp2	UTSW	7	5328129	missense	probably benign
R2334:Nlrp2	UTSW	7	5337535	missense	probably benign	0.39
R3030:Nlrp2	UTSW	7	5327748	missense	probably damaging	1.00
R3404:Nlrp2	UTSW	7	5319287	missense	probably benign	0.01
R3941:Nlrp2	UTSW	7	5327552	nonsense	probably null
R4021:Nlrp2	UTSW	7	5325012	missense	probably benign	0.40
R4518:Nlrp2	UTSW	7	5325056	missense	possibly damaging	0.85
R4666:Nlrp2	UTSW	7	5319189	missense	probably benign	0.18
R4767:Nlrp2	UTSW	7	5328024	missense	probably damaging	1.00
R4827:Nlrp2	UTSW	7	5328951	missense	possibly damaging	0.60
R4873:Nlrp2	UTSW	7	5298859	missense	probably benign	0.09
R4875:Nlrp2	UTSW	7	5298859	missense	probably benign	0.09
R5020:Nlrp2	UTSW	7	5328077	missense	probably damaging	1.00
R5293:Nlrp2	UTSW	7	5327615	missense	probably damaging	1.00
R5310:Nlrp2	UTSW	7	5325008	missense	probably benign	0.00
R5336:Nlrp2	UTSW	7	5328119	missense	probably benign
R5390:Nlrp2	UTSW	7	5300909	missense	probably benign	0.00
R5864:Nlrp2	UTSW	7	5322381	missense	probably damaging	1.00
R5913:Nlrp2	UTSW	7	5324903	splice site	probably null
R6173:Nlrp2	UTSW	7	5337809	missense	probably damaging	0.96
R6274:Nlrp2	UTSW	7	5317555	missense	probably damaging	1.00
R6303:Nlrp2	UTSW	7	5337761	missense	probably damaging	1.00
R6343:Nlrp2	UTSW	7	5300926	missense	possibly damaging	0.82
R6704:Nlrp2	UTSW	7	5325041	nonsense	probably null
R6814:Nlrp2	UTSW	7	5308710	missense	probably benign	0.01
R6872:Nlrp2	UTSW	7	5308710	missense	probably benign	0.01
R7023:Nlrp2	UTSW	7	5328229	nonsense	probably null
R7109:Nlrp2	UTSW	7	5328617	missense	probably damaging	1.00
R7203:Nlrp2	UTSW	7	5317534	missense	probably damaging	1.00
R7322:Nlrp2	UTSW	7	5308645	missense	possibly damaging	0.94
R7339:Nlrp2	UTSW	7	5327628	missense	possibly damaging	0.95
R7573:Nlrp2	UTSW	7	5317469	critical splice donor site	probably null
R7657:Nlrp2	UTSW	7	5319168	missense	probably benign	0.01
R7929:Nlrp2	UTSW	7	5327499	missense	probably damaging	1.00
R7964:Nlrp2	UTSW	7	5328528	missense	probably damaging	1.00
R8097:Nlrp2	UTSW	7	5327651	missense	probably damaging	1.00
R8276:Nlrp2	UTSW	7	5317495	missense	probably benign	0.40
R8785:Nlrp2	UTSW	7	5327549	missense	probably damaging	0.99
R8798:Nlrp2	UTSW	7	5327888	missense	possibly damaging	0.86
R8982:Nlrp2	UTSW	7	5324979	missense	probably damaging	1.00
R9030:Nlrp2	UTSW	7	5322458	missense	probably null	0.00
R9038:Nlrp2	UTSW	7	5327479	missense	probably benign	0.14
R9149:Nlrp2	UTSW	7	5327573	missense	probably benign	0.01
R9229:Nlrp2	UTSW	7	5301053	missense	possibly damaging	0.81
X0027:Nlrp2	UTSW	7	5327642	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TTGCTCCAAGAAGCCCAGAG -3'
(R):5'- AGCAGCTAATGTTAGAATGGTCAG -3'

Sequencing Primer
(F):5'- GAAGCCCAGAGTTTCTACTAGTAGTG -3'
(R):5'- GAGTAAGCAGGCCCAGATTTTCTC -3'

Posted On

2019-05-13