Incidental Mutation 'R7028:Nlrp2'
ID 546123
Institutional Source Beutler Lab
Gene Symbol Nlrp2
Ensembl Gene ENSMUSG00000035177
Gene Name NLR family, pyrin domain containing 2
Synonyms Nbs1, Pan1, PYPAF2, E330007A02Rik, Nalp2
MMRRC Submission 045129-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7028 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 5298547-5351035 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to G at 5328572 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Proline at position 275 (R275P)
Ref Sequence ENSEMBL: ENSMUSP00000045077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045022]
AlphaFold Q4PLS0
Predicted Effect possibly damaging
Transcript: ENSMUST00000045022
AA Change: R275P

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000045077
Gene: ENSMUSG00000035177
AA Change: R275P

DomainStartEndE-ValueType
PYRIN 7 90 2.88e-17 SMART
Pfam:NACHT 180 348 6.9e-30 PFAM
internal_repeat_1 676 722 1.74e-5 PROSPERO
LRR 796 823 1.26e1 SMART
LRR 825 852 1.18e1 SMART
LRR 853 880 5.81e-2 SMART
LRR 882 909 3.39e-3 SMART
LRR 910 937 5.06e-2 SMART
LRR 939 966 5.23e0 SMART
LRR 967 994 3.58e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the nucleotide-binding and leucine-rich repeat receptor (NLR) family, and is predicted to contain an N-terminal pyrin effector domain (PYD), a centrally-located nucleotide-binding and oligomerization domain (NACHT) and C-terminal leucine-rich repeats (LRR). Members of this gene family are thought to be important regulators of immune responses. This gene product interacts with components of the IkB kinase (IKK) complex, and can regulate both caspase-1 and NF-kB (nuclear factor kappa-light-chain-enhancer of activated B cells) activity. The pyrin domain is necessary and sufficient for suppression of NF-kB activity. An allelic variant (rs147585490) has been found that is incapable of blocking the transcriptional activity of NF-kB. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A G 2: 69,265,675 I804T probably benign Het
Abcb1b A T 5: 8,805,441 E25V probably damaging Het
Adamts9 G T 6: 92,909,793 Y355* probably null Het
Akp3 A G 1: 87,126,778 M303V probably benign Het
Ankrd35 A T 3: 96,683,334 E312V possibly damaging Het
Arhgap40 T C 2: 158,531,374 probably null Het
Asxl1 T C 2: 153,400,107 L859P probably benign Het
Atat1 A G 17: 35,910,005 F11L probably benign Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Ccdc7a A T 8: 128,881,594 H943Q unknown Het
Cep135 A G 5: 76,616,848 T558A probably benign Het
Cfap99 A G 5: 34,301,519 E86G possibly damaging Het
Cfhr2 C T 1: 139,831,063 probably null Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Col17a1 G A 19: 47,652,183 P992L probably damaging Het
Col7a1 C T 9: 108,963,263 Q1294* probably null Het
Coq8b T A 7: 27,239,868 C148S probably damaging Het
Csmd2 A G 4: 128,277,228 N338S Het
Cspg5 T A 9: 110,246,891 S232T possibly damaging Het
Cyp2c67 A G 19: 39,639,897 V201A possibly damaging Het
Dlgap3 G A 4: 127,195,517 R302H possibly damaging Het
Dpy19l2 T C 9: 24,628,251 I469V probably benign Het
Fam135b T C 15: 71,471,563 D401G probably damaging Het
Gabbr1 G T 17: 37,064,737 G453* probably null Het
Gclc C A 9: 77,788,216 A440D probably damaging Het
Glyat T C 19: 12,650,359 I106T probably benign Het
Gm12185 T C 11: 48,908,244 N474S possibly damaging Het
Gm17079 T C 14: 51,693,037 H117R Het
Gm884 C T 11: 103,614,537 A26T probably benign Het
Ildr2 A G 1: 166,303,529 D318G probably damaging Het
Kcnd2 G A 6: 21,216,178 probably benign Het
Kif19a C T 11: 114,781,208 T207M probably damaging Het
Kif3a G T 11: 53,586,906 G401* probably null Het
Lactbl1 T A 4: 136,632,975 L155Q probably damaging Het
Lrp1b T A 2: 41,246,011 D1649V probably benign Het
Map2k1 A G 9: 64,193,823 V191A probably benign Het
Mdm4 A T 1: 133,003,809 C165S probably benign Het
Med27 G A 2: 29,509,434 W92* probably null Het
Muc20 A T 16: 32,794,246 S254T probably benign Het
Myh1 A G 11: 67,220,421 E1562G possibly damaging Het
Notch2 T A 3: 98,102,387 N543K probably damaging Het
Nup214 T A 2: 32,034,156 S1566T probably benign Het
Nxnl1 T G 8: 71,562,793 E157A possibly damaging Het
Obscn A G 11: 59,079,133 L61P probably damaging Het
Ogg1 A T 6: 113,329,276 I145F probably damaging Het
Olfr1359 A G 13: 21,703,270 K90E possibly damaging Het
Olfr453 G A 6: 42,744,403 R122H probably benign Het
Olfr572 T C 7: 102,927,942 F105L probably damaging Het
Olfr976 T C 9: 39,956,345 T197A probably benign Het
Pclo A G 5: 14,713,447 D3978G unknown Het
Pla2g4e T G 2: 120,170,195 D687A probably damaging Het
Pla2r1 T C 2: 60,458,393 K632E probably damaging Het
Plg A T 17: 12,391,836 Q212L probably damaging Het
Poldip3 A T 15: 83,131,497 N306K probably damaging Het
Pspn A G 17: 56,999,978 L13P possibly damaging Het
Ralgapa1 T C 12: 55,758,059 E484G probably damaging Het
Rbmxl1 G T 8: 78,506,657 T19K probably damaging Het
Rora G A 9: 69,196,083 V31I possibly damaging Het
Skint5 C A 4: 113,940,839 W182C probably damaging Het
Spata31d1c A T 13: 65,036,063 Q473L probably damaging Het
Tesk2 G A 4: 116,802,687 W334* probably null Het
Tmem67 C A 4: 12,075,484 V277L probably benign Het
Trhde A G 10: 114,518,177 M537T probably damaging Het
Ttc30a2 A T 2: 75,976,269 L633* probably null Het
Tubb6 G A 18: 67,401,911 M293I probably benign Het
Ube2ql1 A T 13: 69,738,754 L196Q probably damaging Het
Ubn1 A T 16: 5,055,324 N70I probably damaging Het
Ubtf A T 11: 102,314,980 S40T probably benign Het
Virma C T 4: 11,519,249 A782V possibly damaging Het
Xdh G T 17: 73,943,873 T28K probably damaging Het
Xpo4 A G 14: 57,597,051 S691P probably benign Het
Zfat A C 15: 68,180,452 F491V probably damaging Het
Zfp623 T G 15: 75,948,305 V370G probably damaging Het
Other mutations in Nlrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Nlrp2 APN 7 5337548 missense probably benign 0.00
IGL00545:Nlrp2 APN 7 5328252 missense possibly damaging 0.89
IGL01311:Nlrp2 APN 7 5319239 missense possibly damaging 0.92
IGL01345:Nlrp2 APN 7 5317492 missense probably benign 0.16
IGL01583:Nlrp2 APN 7 5337770 missense probably damaging 1.00
IGL01659:Nlrp2 APN 7 5328035 missense probably damaging 1.00
IGL02240:Nlrp2 APN 7 5327823 missense probably damaging 1.00
IGL02353:Nlrp2 APN 7 5337599 missense probably damaging 1.00
IGL02360:Nlrp2 APN 7 5337599 missense probably damaging 1.00
IGL02399:Nlrp2 APN 7 5328810 missense probably damaging 1.00
IGL02441:Nlrp2 APN 7 5335567 critical splice donor site probably null
IGL02588:Nlrp2 APN 7 5327552 nonsense probably null
IGL02803:Nlrp2 APN 7 5328318 missense probably damaging 1.00
IGL02968:Nlrp2 APN 7 5301025 missense possibly damaging 0.81
IGL03342:Nlrp2 APN 7 5317483 missense probably damaging 1.00
BB006:Nlrp2 UTSW 7 5327499 missense probably damaging 1.00
BB016:Nlrp2 UTSW 7 5327499 missense probably damaging 1.00
R0027:Nlrp2 UTSW 7 5322448 missense probably damaging 1.00
R0051:Nlrp2 UTSW 7 5322334 unclassified probably benign
R0079:Nlrp2 UTSW 7 5327730 missense possibly damaging 0.81
R0130:Nlrp2 UTSW 7 5322418 missense possibly damaging 0.77
R0157:Nlrp2 UTSW 7 5308770 missense possibly damaging 0.88
R0201:Nlrp2 UTSW 7 5328329 missense probably benign 0.00
R0276:Nlrp2 UTSW 7 5328109 missense probably benign 0.00
R0288:Nlrp2 UTSW 7 5328545 missense probably benign 0.19
R0332:Nlrp2 UTSW 7 5317630 missense probably damaging 1.00
R0724:Nlrp2 UTSW 7 5319222 missense probably damaging 1.00
R1241:Nlrp2 UTSW 7 5328431 missense probably damaging 1.00
R1355:Nlrp2 UTSW 7 5327491 missense possibly damaging 0.81
R1392:Nlrp2 UTSW 7 5329015 splice site probably benign
R1470:Nlrp2 UTSW 7 5300951 missense probably benign 0.18
R1470:Nlrp2 UTSW 7 5300951 missense probably benign 0.18
R1563:Nlrp2 UTSW 7 5308725 missense probably damaging 1.00
R1866:Nlrp2 UTSW 7 5327716 nonsense probably null
R1942:Nlrp2 UTSW 7 5322448 missense probably damaging 1.00
R1959:Nlrp2 UTSW 7 5327738 missense probably damaging 1.00
R1960:Nlrp2 UTSW 7 5327738 missense probably damaging 1.00
R1961:Nlrp2 UTSW 7 5327738 missense probably damaging 1.00
R2072:Nlrp2 UTSW 7 5325006 missense probably damaging 1.00
R2161:Nlrp2 UTSW 7 5325042 missense probably damaging 1.00
R2190:Nlrp2 UTSW 7 5319238 missense possibly damaging 0.95
R2243:Nlrp2 UTSW 7 5335598 missense probably benign 0.03
R2277:Nlrp2 UTSW 7 5328129 missense probably benign
R2334:Nlrp2 UTSW 7 5337535 missense probably benign 0.39
R3030:Nlrp2 UTSW 7 5327748 missense probably damaging 1.00
R3404:Nlrp2 UTSW 7 5319287 missense probably benign 0.01
R3941:Nlrp2 UTSW 7 5327552 nonsense probably null
R4021:Nlrp2 UTSW 7 5325012 missense probably benign 0.40
R4518:Nlrp2 UTSW 7 5325056 missense possibly damaging 0.85
R4666:Nlrp2 UTSW 7 5319189 missense probably benign 0.18
R4767:Nlrp2 UTSW 7 5328024 missense probably damaging 1.00
R4827:Nlrp2 UTSW 7 5328951 missense possibly damaging 0.60
R4873:Nlrp2 UTSW 7 5298859 missense probably benign 0.09
R4875:Nlrp2 UTSW 7 5298859 missense probably benign 0.09
R5020:Nlrp2 UTSW 7 5328077 missense probably damaging 1.00
R5293:Nlrp2 UTSW 7 5327615 missense probably damaging 1.00
R5310:Nlrp2 UTSW 7 5325008 missense probably benign 0.00
R5336:Nlrp2 UTSW 7 5328119 missense probably benign
R5390:Nlrp2 UTSW 7 5300909 missense probably benign 0.00
R5864:Nlrp2 UTSW 7 5322381 missense probably damaging 1.00
R5913:Nlrp2 UTSW 7 5324903 splice site probably null
R6173:Nlrp2 UTSW 7 5337809 missense probably damaging 0.96
R6274:Nlrp2 UTSW 7 5317555 missense probably damaging 1.00
R6303:Nlrp2 UTSW 7 5337761 missense probably damaging 1.00
R6343:Nlrp2 UTSW 7 5300926 missense possibly damaging 0.82
R6704:Nlrp2 UTSW 7 5325041 nonsense probably null
R6814:Nlrp2 UTSW 7 5308710 missense probably benign 0.01
R6872:Nlrp2 UTSW 7 5308710 missense probably benign 0.01
R7023:Nlrp2 UTSW 7 5328229 nonsense probably null
R7109:Nlrp2 UTSW 7 5328617 missense probably damaging 1.00
R7203:Nlrp2 UTSW 7 5317534 missense probably damaging 1.00
R7322:Nlrp2 UTSW 7 5308645 missense possibly damaging 0.94
R7339:Nlrp2 UTSW 7 5327628 missense possibly damaging 0.95
R7573:Nlrp2 UTSW 7 5317469 critical splice donor site probably null
R7657:Nlrp2 UTSW 7 5319168 missense probably benign 0.01
R7929:Nlrp2 UTSW 7 5327499 missense probably damaging 1.00
R7964:Nlrp2 UTSW 7 5328528 missense probably damaging 1.00
R8097:Nlrp2 UTSW 7 5327651 missense probably damaging 1.00
R8276:Nlrp2 UTSW 7 5317495 missense probably benign 0.40
R8785:Nlrp2 UTSW 7 5327549 missense probably damaging 0.99
R8798:Nlrp2 UTSW 7 5327888 missense possibly damaging 0.86
R8982:Nlrp2 UTSW 7 5324979 missense probably damaging 1.00
R9030:Nlrp2 UTSW 7 5322458 missense probably null 0.00
R9038:Nlrp2 UTSW 7 5327479 missense probably benign 0.14
R9149:Nlrp2 UTSW 7 5327573 missense probably benign 0.01
R9229:Nlrp2 UTSW 7 5301053 missense possibly damaging 0.81
R9584:Nlrp2 UTSW 7 5319216 missense probably damaging 1.00
X0027:Nlrp2 UTSW 7 5327642 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTGCTCCAAGAAGCCCAGAG -3'
(R):5'- AGCAGCTAATGTTAGAATGGTCAG -3'

Sequencing Primer
(F):5'- GAAGCCCAGAGTTTCTACTAGTAGTG -3'
(R):5'- GAGTAAGCAGGCCCAGATTTTCTC -3'
Posted On 2019-05-13