Incidental Mutation 'R7028:Gm884'
ID 546143
Institutional Source Beutler Lab
Gene Symbol Gm884
Ensembl Gene ENSMUSG00000034239
Gene Name predicted gene 884
Synonyms LOC380730
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock # R7028 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 103534577-103621140 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 103614537 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 26 (A26T)
Ref Sequence ENSEMBL: ENSMUSP00000129662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059279] [ENSMUST00000167262]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000059279
AA Change: A2202T

PolyPhen 2 Score 0.276 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000058511
Gene: ENSMUSG00000034239
AA Change: A2202T

DomainStartEndE-ValueType
Pfam:LRRC37 149 223 5.4e-10 PFAM
low complexity region 244 264 N/A INTRINSIC
low complexity region 298 308 N/A INTRINSIC
Pfam:LRRC37 335 403 1.9e-14 PFAM
Pfam:LRRC37 419 514 1.2e-8 PFAM
Pfam:LRRC37 565 620 2e-10 PFAM
Pfam:LRRC37 669 739 7.6e-18 PFAM
Pfam:LRRC37 741 792 1.6e-9 PFAM
Pfam:LRRC37 789 860 1.4e-23 PFAM
Pfam:LRRC37 861 914 2.8e-9 PFAM
Pfam:LRRC37 911 983 1.9e-23 PFAM
Pfam:LRRC37 979 1038 1e-8 PFAM
Pfam:LRRC37 1034 1105 2.7e-24 PFAM
Pfam:LRRC37 1105 1158 2.3e-9 PFAM
Pfam:LRRC37 1155 1219 2.4e-17 PFAM
Pfam:LRRC37 1222 1265 9.2e-7 PFAM
Pfam:LRRC37 1263 1330 4.9e-24 PFAM
Pfam:LRRC37 1331 1384 1.4e-10 PFAM
Pfam:LRRC37 1380 1451 4.3e-15 PFAM
Pfam:LRRC37 1487 1558 1.9e-15 PFAM
Pfam:LRRC37 1594 1665 2.9e-18 PFAM
Pfam:LRRC37 1701 1772 5.6e-23 PFAM
Pfam:LRRC37 1808 1910 2.8e-18 PFAM
Pfam:LRRC37 1915 1986 7.2e-17 PFAM
Pfam:LRRC37 2022 2093 4.9e-22 PFAM
Pfam:LRRC37 2129 2200 4.4e-22 PFAM
Pfam:LRRC37 2236 2307 2.1e-21 PFAM
Pfam:LRRC37 2343 2414 3.8e-17 PFAM
Pfam:LRRC37 2449 2519 1.6e-19 PFAM
LRR 2777 2796 3.09e1 SMART
LRR_TYP 2797 2820 2.09e-3 SMART
LRR 2821 2844 4.44e0 SMART
LRR 2848 2872 8.26e1 SMART
low complexity region 2991 3002 N/A INTRINSIC
low complexity region 3220 3230 N/A INTRINSIC
low complexity region 3382 3393 N/A INTRINSIC
Pfam:LRRC37AB_C 3424 3570 7.7e-76 PFAM
low complexity region 3571 3589 N/A INTRINSIC
low complexity region 3622 3640 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167262
AA Change: A26T

PolyPhen 2 Score 0.276 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000129662
Gene: ENSMUSG00000034239
AA Change: A26T

DomainStartEndE-ValueType
internal_repeat_1 1 70 1.46e-11 PROSPERO
internal_repeat_1 108 290 1.46e-11 PROSPERO
LRR 601 620 3.09e1 SMART
LRR_TYP 621 644 2.09e-3 SMART
LRR 645 668 4.44e0 SMART
LRR 672 696 8.26e1 SMART
low complexity region 815 826 N/A INTRINSIC
low complexity region 1044 1054 N/A INTRINSIC
low complexity region 1206 1217 N/A INTRINSIC
Pfam:LRRC37AB_C 1243 1396 1.2e-92 PFAM
low complexity region 1446 1464 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A G 2: 69,265,675 I804T probably benign Het
Abcb1b A T 5: 8,805,441 E25V probably damaging Het
Adamts9 G T 6: 92,909,793 Y355* probably null Het
Akp3 A G 1: 87,126,778 M303V probably benign Het
Ankrd35 A T 3: 96,683,334 E312V possibly damaging Het
Arhgap40 T C 2: 158,531,374 probably null Het
Asxl1 T C 2: 153,400,107 L859P probably benign Het
Atat1 A G 17: 35,910,005 F11L probably benign Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Ccdc7a A T 8: 128,881,594 H943Q unknown Het
Cep135 A G 5: 76,616,848 T558A probably benign Het
Cfap99 A G 5: 34,301,519 E86G possibly damaging Het
Cfhr2 C T 1: 139,831,063 probably null Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Col17a1 G A 19: 47,652,183 P992L probably damaging Het
Col7a1 C T 9: 108,963,263 Q1294* probably null Het
Coq8b T A 7: 27,239,868 C148S probably damaging Het
Csmd2 A G 4: 128,277,228 N338S Het
Cspg5 T A 9: 110,246,891 S232T possibly damaging Het
Cyp2c67 A G 19: 39,639,897 V201A possibly damaging Het
Dlgap3 G A 4: 127,195,517 R302H possibly damaging Het
Dpy19l2 T C 9: 24,628,251 I469V probably benign Het
Fam135b T C 15: 71,471,563 D401G probably damaging Het
Gabbr1 G T 17: 37,064,737 G453* probably null Het
Gclc C A 9: 77,788,216 A440D probably damaging Het
Glyat T C 19: 12,650,359 I106T probably benign Het
Gm12185 T C 11: 48,908,244 N474S possibly damaging Het
Gm17079 T C 14: 51,693,037 H117R Het
Ildr2 A G 1: 166,303,529 D318G probably damaging Het
Kcnd2 G A 6: 21,216,178 probably benign Het
Kif19a C T 11: 114,781,208 T207M probably damaging Het
Kif3a G T 11: 53,586,906 G401* probably null Het
Lactbl1 T A 4: 136,632,975 L155Q probably damaging Het
Lrp1b T A 2: 41,246,011 D1649V probably benign Het
Map2k1 A G 9: 64,193,823 V191A probably benign Het
Mdm4 A T 1: 133,003,809 C165S probably benign Het
Med27 G A 2: 29,509,434 W92* probably null Het
Muc20 A T 16: 32,794,246 S254T probably benign Het
Myh1 A G 11: 67,220,421 E1562G possibly damaging Het
Nlrp2 C G 7: 5,328,572 R275P possibly damaging Het
Notch2 T A 3: 98,102,387 N543K probably damaging Het
Nup214 T A 2: 32,034,156 S1566T probably benign Het
Nxnl1 T G 8: 71,562,793 E157A possibly damaging Het
Obscn A G 11: 59,079,133 L61P probably damaging Het
Ogg1 A T 6: 113,329,276 I145F probably damaging Het
Olfr1359 A G 13: 21,703,270 K90E possibly damaging Het
Olfr453 G A 6: 42,744,403 R122H probably benign Het
Olfr572 T C 7: 102,927,942 F105L probably damaging Het
Olfr976 T C 9: 39,956,345 T197A probably benign Het
Pclo A G 5: 14,713,447 D3978G unknown Het
Pla2g4e T G 2: 120,170,195 D687A probably damaging Het
Pla2r1 T C 2: 60,458,393 K632E probably damaging Het
Plg A T 17: 12,391,836 Q212L probably damaging Het
Poldip3 A T 15: 83,131,497 N306K probably damaging Het
Pspn A G 17: 56,999,978 L13P possibly damaging Het
Ralgapa1 T C 12: 55,758,059 E484G probably damaging Het
Rbmxl1 G T 8: 78,506,657 T19K probably damaging Het
Rora G A 9: 69,196,083 V31I possibly damaging Het
Skint5 C A 4: 113,940,839 W182C probably damaging Het
Spata31d1c A T 13: 65,036,063 Q473L probably damaging Het
Tesk2 G A 4: 116,802,687 W334* probably null Het
Tmem67 C A 4: 12,075,484 V277L probably benign Het
Trhde A G 10: 114,518,177 M537T probably damaging Het
Ttc30a2 A T 2: 75,976,269 L633* probably null Het
Tubb6 G A 18: 67,401,911 M293I probably benign Het
Ube2ql1 A T 13: 69,738,754 L196Q probably damaging Het
Ubn1 A T 16: 5,055,324 N70I probably damaging Het
Ubtf A T 11: 102,314,980 S40T probably benign Het
Virma C T 4: 11,519,249 A782V possibly damaging Het
Xdh G T 17: 73,943,873 T28K probably damaging Het
Xpo4 A G 14: 57,597,051 S691P probably benign Het
Zfat A C 15: 68,180,452 F491V probably damaging Het
Zfp623 T G 15: 75,948,305 V370G probably damaging Het
Other mutations in Gm884
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Gm884 APN 11 103615410 missense probably benign 0.01
IGL00576:Gm884 APN 11 103617386 unclassified probably benign
IGL00813:Gm884 APN 11 103614498 missense probably benign 0.05
IGL01311:Gm884 APN 11 103534676 missense unknown
IGL01946:Gm884 APN 11 103612933 missense probably benign 0.28
IGL02217:Gm884 APN 11 103612871 splice site probably benign
IGL02556:Gm884 APN 11 103613283 missense probably benign 0.01
IGL02825:Gm884 APN 11 103617068 unclassified probably benign
IGL02868:Gm884 APN 11 103615139 missense probably benign 0.10
IGL02904:Gm884 APN 11 103616361 unclassified probably benign
IGL03008:Gm884 APN 11 103620467 missense unknown
IGL03120:Gm884 APN 11 103616975 unclassified probably benign
IGL03159:Gm884 APN 11 103604502 splice site probably benign
IGL03181:Gm884 APN 11 103616416 unclassified probably benign
IGL03202:Gm884 APN 11 103615373 missense probably benign 0.03
IGL03263:Gm884 APN 11 103613699 missense possibly damaging 0.86
esteemed UTSW 11 103618830 missense unknown
lauded UTSW 11 103613103 missense possibly damaging 0.62
PIT4486001:Gm884 UTSW 11 103618201 missense unknown
R0040:Gm884 UTSW 11 103542990 missense probably damaging 0.99
R0135:Gm884 UTSW 11 103618047 unclassified probably benign
R0141:Gm884 UTSW 11 103613686 missense probably damaging 1.00
R0226:Gm884 UTSW 11 103603241 missense probably benign 0.08
R0547:Gm884 UTSW 11 103620164 missense unknown
R0646:Gm884 UTSW 11 103613160 nonsense probably null
R0685:Gm884 UTSW 11 103616888 unclassified probably benign
R0732:Gm884 UTSW 11 103619838 missense unknown
R1015:Gm884 UTSW 11 103545796 missense probably benign 0.01
R1166:Gm884 UTSW 11 103615383 missense probably benign 0.21
R1168:Gm884 UTSW 11 103618950 unclassified probably benign
R1257:Gm884 UTSW 11 103534641 missense unknown
R1545:Gm884 UTSW 11 103608919 missense probably benign 0.16
R1570:Gm884 UTSW 11 103609938 missense possibly damaging 0.76
R1677:Gm884 UTSW 11 103614942 missense probably benign 0.19
R1703:Gm884 UTSW 11 103540874 missense probably benign 0.39
R1719:Gm884 UTSW 11 103617071 unclassified probably benign
R1752:Gm884 UTSW 11 103614555 missense possibly damaging 0.67
R1870:Gm884 UTSW 11 103620605 missense unknown
R2155:Gm884 UTSW 11 103620459 missense unknown
R2191:Gm884 UTSW 11 103618967 unclassified probably benign
R2271:Gm884 UTSW 11 103614207 missense possibly damaging 0.53
R2378:Gm884 UTSW 11 103619711 unclassified probably benign
R2405:Gm884 UTSW 11 103620984 missense unknown
R2864:Gm884 UTSW 11 103540918 missense probably benign 0.34
R3011:Gm884 UTSW 11 103613103 missense possibly damaging 0.62
R3415:Gm884 UTSW 11 103614609 missense possibly damaging 0.82
R3417:Gm884 UTSW 11 103614609 missense possibly damaging 0.82
R3835:Gm884 UTSW 11 103620010 missense unknown
R3974:Gm884 UTSW 11 103619101 unclassified probably benign
R4019:Gm884 UTSW 11 103615293 missense probably benign 0.19
R4020:Gm884 UTSW 11 103615293 missense probably benign 0.19
R4176:Gm884 UTSW 11 103536600 missense unknown
R4361:Gm884 UTSW 11 103617501 frame shift probably null
R4418:Gm884 UTSW 11 103618314 unclassified probably benign
R4633:Gm884 UTSW 11 103619131 unclassified probably benign
R4693:Gm884 UTSW 11 103619860 missense unknown
R4758:Gm884 UTSW 11 103614464 missense possibly damaging 0.48
R4878:Gm884 UTSW 11 103617891 unclassified probably benign
R4887:Gm884 UTSW 11 103614872 missense probably benign 0.03
R4944:Gm884 UTSW 11 103613460 missense possibly damaging 0.68
R4952:Gm884 UTSW 11 103614207 missense possibly damaging 0.53
R5030:Gm884 UTSW 11 103534849 missense unknown
R5183:Gm884 UTSW 11 103543121 missense probably damaging 0.99
R5294:Gm884 UTSW 11 103616231 unclassified probably benign
R5317:Gm884 UTSW 11 103614145 missense possibly damaging 0.73
R5334:Gm884 UTSW 11 103613873 missense probably benign 0.18
R5426:Gm884 UTSW 11 103620760 missense unknown
R5467:Gm884 UTSW 11 103603265 nonsense probably null
R5518:Gm884 UTSW 11 103615253 missense probably benign 0.03
R5634:Gm884 UTSW 11 103542014 missense possibly damaging 0.95
R5647:Gm884 UTSW 11 103617474 unclassified probably benign
R5663:Gm884 UTSW 11 103613123 missense probably benign 0.01
R5668:Gm884 UTSW 11 103617054 unclassified probably benign
R5763:Gm884 UTSW 11 103613643 missense probably damaging 0.97
R5829:Gm884 UTSW 11 103541886 missense possibly damaging 0.95
R5871:Gm884 UTSW 11 103616454 unclassified probably benign
R5905:Gm884 UTSW 11 103614255 missense probably damaging 0.98
R5940:Gm884 UTSW 11 103613886 missense probably benign 0.18
R5964:Gm884 UTSW 11 103542120 missense possibly damaging 0.92
R5988:Gm884 UTSW 11 103615896 unclassified probably benign
R5992:Gm884 UTSW 11 103613792 missense possibly damaging 0.81
R6114:Gm884 UTSW 11 103617791 unclassified probably benign
R6154:Gm884 UTSW 11 103614143 missense probably benign 0.33
R6233:Gm884 UTSW 11 103613388 missense probably damaging 0.98
R6301:Gm884 UTSW 11 103618930 unclassified probably benign
R6362:Gm884 UTSW 11 103620652 missense unknown
R6471:Gm884 UTSW 11 103619622 unclassified probably benign
R6806:Gm884 UTSW 11 103621124 missense unknown
R6962:Gm884 UTSW 11 103614300 missense possibly damaging 0.67
R6996:Gm884 UTSW 11 103618757 nonsense probably null
R7034:Gm884 UTSW 11 103615812 unclassified probably benign
R7036:Gm884 UTSW 11 103615812 unclassified probably benign
R7113:Gm884 UTSW 11 103618799 missense unknown
R7405:Gm884 UTSW 11 103615161 missense probably benign 0.02
R7420:Gm884 UTSW 11 103613625 missense probably benign 0.11
R7461:Gm884 UTSW 11 103616290 missense unknown
R7544:Gm884 UTSW 11 103615448 missense probably benign 0.01
R7613:Gm884 UTSW 11 103616290 missense unknown
R7711:Gm884 UTSW 11 103614912 missense probably benign 0.02
R7714:Gm884 UTSW 11 103616893 missense unknown
R7747:Gm884 UTSW 11 103614255 missense probably damaging 0.98
R7814:Gm884 UTSW 11 103614173 missense possibly damaging 0.53
R8053:Gm884 UTSW 11 103604566 missense unknown
R8063:Gm884 UTSW 11 103542261 missense unknown
R8116:Gm884 UTSW 11 103543289 missense unknown
R8124:Gm884 UTSW 11 103620431 missense unknown
R8141:Gm884 UTSW 11 103621029 missense unknown
R8163:Gm884 UTSW 11 103615862 missense unknown
R8270:Gm884 UTSW 11 103543315 missense unknown
R8348:Gm884 UTSW 11 103620900 missense unknown
R8362:Gm884 UTSW 11 103615337 missense probably benign 0.34
R8448:Gm884 UTSW 11 103620900 missense unknown
R8465:Gm884 UTSW 11 103616121 unclassified probably benign
R8473:Gm884 UTSW 11 103543440 missense unknown
R8781:Gm884 UTSW 11 103618132 missense unknown
R8821:Gm884 UTSW 11 103619644 missense unknown
R8859:Gm884 UTSW 11 103615544 missense unknown
R8888:Gm884 UTSW 11 103618830 missense unknown
R8895:Gm884 UTSW 11 103618830 missense unknown
R9083:Gm884 UTSW 11 103619004 missense unknown
R9085:Gm884 UTSW 11 103616739 missense unknown
R9088:Gm884 UTSW 11 103620936 missense unknown
R9124:Gm884 UTSW 11 103618895 missense unknown
R9177:Gm884 UTSW 11 103617437 missense unknown
R9238:Gm884 UTSW 11 103619033 missense unknown
R9267:Gm884 UTSW 11 103604580 missense unknown
Z1176:Gm884 UTSW 11 103613681 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- TAGAGTGTGAGCTGCAACCTC -3'
(R):5'- TACTTCAAAATCTAATCCTGGGCAG -3'

Sequencing Primer
(F):5'- AGAGTGTGAGCTGCAACCTCTTTAG -3'
(R):5'- GGGCAGGAGAACCCAACTC -3'
Posted On 2019-05-13