Incidental Mutation 'R7028:Ralgapa1'
ID 546145
Institutional Source Beutler Lab
Gene Symbol Ralgapa1
Ensembl Gene ENSMUSG00000021027
Gene Name Ral GTPase activating protein, alpha subunit 1
Synonyms Garnl1, 4930400K19Rik, 2310003F20Rik, Tulip1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.745) question?
Stock # R7028 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 55602896-55821167 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 55758059 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 484 (E484G)
Ref Sequence ENSEMBL: ENSMUSP00000151857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085385] [ENSMUST00000110687] [ENSMUST00000219432] [ENSMUST00000220367] [ENSMUST00000226244]
AlphaFold Q6GYP7
Predicted Effect probably benign
Transcript: ENSMUST00000085385
AA Change: E484G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000082503
Gene: ENSMUSG00000021027
AA Change: E484G

DomainStartEndE-ValueType
low complexity region 644 651 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 894 915 N/A INTRINSIC
low complexity region 1386 1395 N/A INTRINSIC
low complexity region 1784 1798 N/A INTRINSIC
Pfam:Rap_GAP 1824 2003 7.4e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110687
AA Change: E484G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000106315
Gene: ENSMUSG00000021027
AA Change: E484G

DomainStartEndE-ValueType
low complexity region 644 651 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 894 915 N/A INTRINSIC
low complexity region 1386 1395 N/A INTRINSIC
low complexity region 1784 1798 N/A INTRINSIC
Pfam:Rap_GAP 1824 2001 1.9e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000219432
AA Change: E484G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect possibly damaging
Transcript: ENSMUST00000220367
AA Change: E484G

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000226244
AA Change: E484G

PolyPhen 2 Score 0.393 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a major subunit of the RAL-GTPase activating protein. A similar protein in mouse binds E12, a transcriptional regulator of immunoglobulin genes. The mouse protein also functions in skeletal muscle by binding to the regulatory 14-3-3 proteins upon stimulation with insulin or muscle contraction. A pseudogene of this gene has been identified on chromosome 9. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A G 2: 69,265,675 I804T probably benign Het
Abcb1b A T 5: 8,805,441 E25V probably damaging Het
Adamts9 G T 6: 92,909,793 Y355* probably null Het
Akp3 A G 1: 87,126,778 M303V probably benign Het
Ankrd35 A T 3: 96,683,334 E312V possibly damaging Het
Arhgap40 T C 2: 158,531,374 probably null Het
Asxl1 T C 2: 153,400,107 L859P probably benign Het
Atat1 A G 17: 35,910,005 F11L probably benign Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Ccdc7a A T 8: 128,881,594 H943Q unknown Het
Cep135 A G 5: 76,616,848 T558A probably benign Het
Cfap99 A G 5: 34,301,519 E86G possibly damaging Het
Cfhr2 C T 1: 139,831,063 probably null Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Col17a1 G A 19: 47,652,183 P992L probably damaging Het
Col7a1 C T 9: 108,963,263 Q1294* probably null Het
Coq8b T A 7: 27,239,868 C148S probably damaging Het
Csmd2 A G 4: 128,277,228 N338S Het
Cspg5 T A 9: 110,246,891 S232T possibly damaging Het
Cyp2c67 A G 19: 39,639,897 V201A possibly damaging Het
Dlgap3 G A 4: 127,195,517 R302H possibly damaging Het
Dpy19l2 T C 9: 24,628,251 I469V probably benign Het
Fam135b T C 15: 71,471,563 D401G probably damaging Het
Gabbr1 G T 17: 37,064,737 G453* probably null Het
Gclc C A 9: 77,788,216 A440D probably damaging Het
Glyat T C 19: 12,650,359 I106T probably benign Het
Gm12185 T C 11: 48,908,244 N474S possibly damaging Het
Gm17079 T C 14: 51,693,037 H117R Het
Gm884 C T 11: 103,614,537 A26T probably benign Het
Ildr2 A G 1: 166,303,529 D318G probably damaging Het
Kcnd2 G A 6: 21,216,178 probably benign Het
Kif19a C T 11: 114,781,208 T207M probably damaging Het
Kif3a G T 11: 53,586,906 G401* probably null Het
Lactbl1 T A 4: 136,632,975 L155Q probably damaging Het
Lrp1b T A 2: 41,246,011 D1649V probably benign Het
Map2k1 A G 9: 64,193,823 V191A probably benign Het
Mdm4 A T 1: 133,003,809 C165S probably benign Het
Med27 G A 2: 29,509,434 W92* probably null Het
Muc20 A T 16: 32,794,246 S254T probably benign Het
Myh1 A G 11: 67,220,421 E1562G possibly damaging Het
Nlrp2 C G 7: 5,328,572 R275P possibly damaging Het
Notch2 T A 3: 98,102,387 N543K probably damaging Het
Nup214 T A 2: 32,034,156 S1566T probably benign Het
Nxnl1 T G 8: 71,562,793 E157A possibly damaging Het
Obscn A G 11: 59,079,133 L61P probably damaging Het
Ogg1 A T 6: 113,329,276 I145F probably damaging Het
Olfr1359 A G 13: 21,703,270 K90E possibly damaging Het
Olfr453 G A 6: 42,744,403 R122H probably benign Het
Olfr572 T C 7: 102,927,942 F105L probably damaging Het
Olfr976 T C 9: 39,956,345 T197A probably benign Het
Pclo A G 5: 14,713,447 D3978G unknown Het
Pla2g4e T G 2: 120,170,195 D687A probably damaging Het
Pla2r1 T C 2: 60,458,393 K632E probably damaging Het
Plg A T 17: 12,391,836 Q212L probably damaging Het
Poldip3 A T 15: 83,131,497 N306K probably damaging Het
Pspn A G 17: 56,999,978 L13P possibly damaging Het
Rbmxl1 G T 8: 78,506,657 T19K probably damaging Het
Rora G A 9: 69,196,083 V31I possibly damaging Het
Skint5 C A 4: 113,940,839 W182C probably damaging Het
Spata31d1c A T 13: 65,036,063 Q473L probably damaging Het
Tesk2 G A 4: 116,802,687 W334* probably null Het
Tmem67 C A 4: 12,075,484 V277L probably benign Het
Trhde A G 10: 114,518,177 M537T probably damaging Het
Ttc30a2 A T 2: 75,976,269 L633* probably null Het
Tubb6 G A 18: 67,401,911 M293I probably benign Het
Ube2ql1 A T 13: 69,738,754 L196Q probably damaging Het
Ubn1 A T 16: 5,055,324 N70I probably damaging Het
Ubtf A T 11: 102,314,980 S40T probably benign Het
Virma C T 4: 11,519,249 A782V possibly damaging Het
Xdh G T 17: 73,943,873 T28K probably damaging Het
Xpo4 A G 14: 57,597,051 S691P probably benign Het
Zfat A C 15: 68,180,452 F491V probably damaging Het
Zfp623 T G 15: 75,948,305 V370G probably damaging Het
Other mutations in Ralgapa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Ralgapa1 APN 12 55722773 missense probably damaging 0.98
IGL00494:Ralgapa1 APN 12 55747185 missense probably damaging 1.00
IGL00731:Ralgapa1 APN 12 55702452 missense possibly damaging 0.94
IGL00851:Ralgapa1 APN 12 55709575 missense possibly damaging 0.93
IGL01133:Ralgapa1 APN 12 55642348 missense probably damaging 1.00
IGL01133:Ralgapa1 APN 12 55642359 missense probably damaging 0.99
IGL01354:Ralgapa1 APN 12 55777316 missense possibly damaging 0.68
IGL01514:Ralgapa1 APN 12 55719657 missense probably damaging 0.97
IGL02033:Ralgapa1 APN 12 55642477 missense possibly damaging 0.69
IGL02064:Ralgapa1 APN 12 55708077 missense probably damaging 1.00
IGL02556:Ralgapa1 APN 12 55642449 missense possibly damaging 0.80
IGL02605:Ralgapa1 APN 12 55712665 missense possibly damaging 0.90
IGL02657:Ralgapa1 APN 12 55673507 missense probably damaging 1.00
IGL02676:Ralgapa1 APN 12 55676417 missense probably damaging 1.00
IGL02894:Ralgapa1 APN 12 55717069 missense possibly damaging 0.79
IGL02944:Ralgapa1 APN 12 55757951 missense probably benign 0.01
Anhydrous UTSW 12 55795778 critical splice acceptor site probably null
Aqueous UTSW 12 55698854 missense probably damaging 1.00
bantam UTSW 12 55722773 critical splice donor site probably null
Deliquescent UTSW 12 55782900 splice site probably benign
wickedwarlock UTSW 12 55777292 missense probably null 0.99
F5770:Ralgapa1 UTSW 12 55795653 splice site probably benign
IGL03046:Ralgapa1 UTSW 12 55695157 missense probably damaging 1.00
R0011:Ralgapa1 UTSW 12 55786263 missense probably damaging 0.99
R0096:Ralgapa1 UTSW 12 55739505 missense probably damaging 1.00
R0277:Ralgapa1 UTSW 12 55677238 missense probably damaging 0.99
R0323:Ralgapa1 UTSW 12 55677238 missense probably damaging 0.99
R0333:Ralgapa1 UTSW 12 55782900 splice site probably benign
R0361:Ralgapa1 UTSW 12 55676569 missense possibly damaging 0.93
R0385:Ralgapa1 UTSW 12 55677038 missense probably damaging 1.00
R0386:Ralgapa1 UTSW 12 55708067 missense probably benign 0.03
R0498:Ralgapa1 UTSW 12 55689791 missense possibly damaging 0.66
R0552:Ralgapa1 UTSW 12 55676765 missense probably benign 0.27
R0564:Ralgapa1 UTSW 12 55782885 missense possibly damaging 0.84
R0611:Ralgapa1 UTSW 12 55795698 missense probably damaging 0.99
R0730:Ralgapa1 UTSW 12 55665663 missense probably damaging 1.00
R0741:Ralgapa1 UTSW 12 55676581 missense probably damaging 0.99
R0815:Ralgapa1 UTSW 12 55762681 nonsense probably null
R0815:Ralgapa1 UTSW 12 55782777 splice site probably benign
R0863:Ralgapa1 UTSW 12 55762681 nonsense probably null
R0863:Ralgapa1 UTSW 12 55782777 splice site probably benign
R1068:Ralgapa1 UTSW 12 55790310 critical splice donor site probably null
R1147:Ralgapa1 UTSW 12 55702480 missense probably damaging 1.00
R1147:Ralgapa1 UTSW 12 55702480 missense probably damaging 1.00
R1256:Ralgapa1 UTSW 12 55762661 missense possibly damaging 0.94
R1343:Ralgapa1 UTSW 12 55707978 missense probably damaging 1.00
R1378:Ralgapa1 UTSW 12 55676926 missense probably damaging 1.00
R1474:Ralgapa1 UTSW 12 55741480 missense probably benign 0.09
R1494:Ralgapa1 UTSW 12 55684524 missense probably damaging 0.99
R1593:Ralgapa1 UTSW 12 55770703 missense probably damaging 1.00
R1607:Ralgapa1 UTSW 12 55741536 missense probably damaging 1.00
R1681:Ralgapa1 UTSW 12 55762603 missense probably benign 0.35
R1689:Ralgapa1 UTSW 12 55676767 missense possibly damaging 0.79
R1714:Ralgapa1 UTSW 12 55642389 missense probably damaging 1.00
R1832:Ralgapa1 UTSW 12 55757967 missense probably benign 0.03
R1870:Ralgapa1 UTSW 12 55677032 missense possibly damaging 0.66
R2040:Ralgapa1 UTSW 12 55786322 missense probably damaging 1.00
R2043:Ralgapa1 UTSW 12 55677026 missense probably damaging 0.99
R2046:Ralgapa1 UTSW 12 55695160 missense probably damaging 1.00
R2109:Ralgapa1 UTSW 12 55776188 missense possibly damaging 0.90
R2114:Ralgapa1 UTSW 12 55786349 critical splice acceptor site probably null
R2115:Ralgapa1 UTSW 12 55786349 critical splice acceptor site probably null
R2202:Ralgapa1 UTSW 12 55612800 splice site probably null
R2203:Ralgapa1 UTSW 12 55612800 splice site probably null
R2233:Ralgapa1 UTSW 12 55717071 missense probably benign 0.13
R2235:Ralgapa1 UTSW 12 55717071 missense probably benign 0.13
R2341:Ralgapa1 UTSW 12 55677124 missense possibly damaging 0.66
R2507:Ralgapa1 UTSW 12 55718201 missense probably damaging 1.00
R2508:Ralgapa1 UTSW 12 55718201 missense probably damaging 1.00
R2972:Ralgapa1 UTSW 12 55820755 missense possibly damaging 0.61
R3160:Ralgapa1 UTSW 12 55709586 missense probably damaging 1.00
R3162:Ralgapa1 UTSW 12 55709586 missense probably damaging 1.00
R3401:Ralgapa1 UTSW 12 55659137 missense possibly damaging 0.66
R3416:Ralgapa1 UTSW 12 55770613 splice site probably benign
R3499:Ralgapa1 UTSW 12 55695143 splice site probably benign
R3799:Ralgapa1 UTSW 12 55659130 missense probably damaging 1.00
R3948:Ralgapa1 UTSW 12 55698767 missense probably damaging 1.00
R4039:Ralgapa1 UTSW 12 55795701 missense probably damaging 0.99
R4120:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4165:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4166:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4212:Ralgapa1 UTSW 12 55739330 critical splice donor site probably null
R4232:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4233:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4234:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4235:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4399:Ralgapa1 UTSW 12 55795778 critical splice acceptor site probably null
R4698:Ralgapa1 UTSW 12 55677276 splice site probably null
R4715:Ralgapa1 UTSW 12 55693458 missense probably damaging 1.00
R4755:Ralgapa1 UTSW 12 55712748 missense probably damaging 1.00
R4810:Ralgapa1 UTSW 12 55794993 critical splice donor site probably null
R4827:Ralgapa1 UTSW 12 55676437 missense probably damaging 1.00
R4849:Ralgapa1 UTSW 12 55698803 missense probably damaging 0.99
R4934:Ralgapa1 UTSW 12 55762574 missense possibly damaging 0.94
R5006:Ralgapa1 UTSW 12 55718114 missense probably benign 0.02
R5114:Ralgapa1 UTSW 12 55612723 missense possibly damaging 0.84
R5140:Ralgapa1 UTSW 12 55776152 missense probably damaging 1.00
R5140:Ralgapa1 UTSW 12 55665674 missense probably damaging 1.00
R5168:Ralgapa1 UTSW 12 55758032 missense probably benign 0.05
R5407:Ralgapa1 UTSW 12 55676797 missense possibly damaging 0.93
R5441:Ralgapa1 UTSW 12 55719623 missense probably damaging 1.00
R5473:Ralgapa1 UTSW 12 55676710 missense probably benign 0.41
R5624:Ralgapa1 UTSW 12 55612738 missense probably damaging 1.00
R5766:Ralgapa1 UTSW 12 55820766 start codon destroyed probably null 0.99
R5826:Ralgapa1 UTSW 12 55677113 missense probably damaging 1.00
R5950:Ralgapa1 UTSW 12 55738265 missense possibly damaging 0.58
R5980:Ralgapa1 UTSW 12 55770616 splice site probably null
R6019:Ralgapa1 UTSW 12 55684042 missense possibly damaging 0.92
R6065:Ralgapa1 UTSW 12 55757924 critical splice donor site probably null
R6326:Ralgapa1 UTSW 12 55747146 missense probably damaging 1.00
R6355:Ralgapa1 UTSW 12 55698854 missense probably damaging 1.00
R6408:Ralgapa1 UTSW 12 55683910 nonsense probably null
R6448:Ralgapa1 UTSW 12 55719661 missense probably benign 0.14
R6453:Ralgapa1 UTSW 12 55738319 missense probably damaging 1.00
R6590:Ralgapa1 UTSW 12 55722773 critical splice donor site probably null
R6690:Ralgapa1 UTSW 12 55722773 critical splice donor site probably null
R6738:Ralgapa1 UTSW 12 55762727 missense probably damaging 1.00
R6836:Ralgapa1 UTSW 12 55604273 splice site probably null
R6936:Ralgapa1 UTSW 12 55786212 missense probably damaging 0.99
R6945:Ralgapa1 UTSW 12 55776191 missense possibly damaging 0.64
R7075:Ralgapa1 UTSW 12 55820723 missense possibly damaging 0.66
R7076:Ralgapa1 UTSW 12 55721576 missense possibly damaging 0.82
R7098:Ralgapa1 UTSW 12 55790310 critical splice donor site probably null
R7231:Ralgapa1 UTSW 12 55604191 missense probably damaging 1.00
R7254:Ralgapa1 UTSW 12 55695193 missense probably damaging 1.00
R7326:Ralgapa1 UTSW 12 55709004 missense probably damaging 1.00
R7485:Ralgapa1 UTSW 12 55712672 missense probably damaging 1.00
R7580:Ralgapa1 UTSW 12 55718228 missense probably benign 0.00
R7677:Ralgapa1 UTSW 12 55659143 missense probably damaging 0.96
R7702:Ralgapa1 UTSW 12 55709555 missense probably damaging 1.00
R7702:Ralgapa1 UTSW 12 55709556 missense probably damaging 1.00
R7707:Ralgapa1 UTSW 12 55777292 missense probably null 0.99
R7723:Ralgapa1 UTSW 12 55741513 missense probably benign
R7763:Ralgapa1 UTSW 12 55757955 missense probably benign 0.28
R7791:Ralgapa1 UTSW 12 55741519 missense probably damaging 0.97
R7812:Ralgapa1 UTSW 12 55719628 missense possibly damaging 0.67
R7868:Ralgapa1 UTSW 12 55612638 missense probably benign 0.00
R7895:Ralgapa1 UTSW 12 55747149 missense probably benign 0.44
R7896:Ralgapa1 UTSW 12 55697878 missense probably benign 0.01
R8004:Ralgapa1 UTSW 12 55702457 missense probably damaging 0.99
R8094:Ralgapa1 UTSW 12 55782846 missense probably damaging 0.99
R8213:Ralgapa1 UTSW 12 55722914 missense probably damaging 0.99
R8307:Ralgapa1 UTSW 12 55741523 missense probably damaging 0.99
R8423:Ralgapa1 UTSW 12 55659062 missense probably damaging 0.99
R8462:Ralgapa1 UTSW 12 55676518 missense possibly damaging 0.90
R8469:Ralgapa1 UTSW 12 55739413 missense probably damaging 1.00
R8675:Ralgapa1 UTSW 12 55738217 missense possibly damaging 0.93
R8802:Ralgapa1 UTSW 12 55738316 missense probably damaging 0.99
R8937:Ralgapa1 UTSW 12 55702560 missense probably damaging 0.96
R8953:Ralgapa1 UTSW 12 55820761 missense probably damaging 0.99
R8974:Ralgapa1 UTSW 12 55677006 missense probably benign
R9089:Ralgapa1 UTSW 12 55676566 missense probably damaging 0.97
R9124:Ralgapa1 UTSW 12 55735096 missense probably damaging 1.00
R9254:Ralgapa1 UTSW 12 55722798 missense probably damaging 1.00
R9320:Ralgapa1 UTSW 12 55709058 missense possibly damaging 0.59
R9379:Ralgapa1 UTSW 12 55722798 missense probably damaging 1.00
Z1176:Ralgapa1 UTSW 12 55709080 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAATCCCAAAGTATAGGCATTTGAAC -3'
(R):5'- TTACAGACTTCACGCCTGAG -3'

Sequencing Primer
(F):5'- AGAGAACTTGCCTTGCATGC -3'
(R):5'- AGACTTCACGCCTGAGTCATC -3'
Posted On 2019-05-13