Mutagenetix > Incidental Mutation

Incidental Mutation 'R7028:Ralgapa1'

546145

Institutional Source

Beutler Lab

Gene Symbol

Ralgapa1

Ensembl Gene

ENSMUSG00000021027

Gene Name

Ral GTPase activating protein, alpha subunit 1

Synonyms

Garnl1, 4930400K19Rik, 2310003F20Rik, Tulip1

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.855) question?

Stock #

R7028 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

55602896-55821167 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 55758059 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 484 (E484G)

Ref Sequence

ENSEMBL: ENSMUSP00000151857 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085385] [ENSMUST00000110687] [ENSMUST00000219432] [ENSMUST00000220367] [ENSMUST00000226244]

AlphaFold

Q6GYP7

Predicted Effect

probably benign
Transcript: ENSMUST00000085385
AA Change: E484G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000082503
Gene: ENSMUSG00000021027
AA Change: E484G

Domain	Start	End	E-Value	Type
low complexity region	644	651	N/A	INTRINSIC
low complexity region	676	690	N/A	INTRINSIC
low complexity region	692	704	N/A	INTRINSIC
low complexity region	894	915	N/A	INTRINSIC
low complexity region	1386	1395	N/A	INTRINSIC
low complexity region	1784	1798	N/A	INTRINSIC
Pfam:Rap_GAP	1824	2003	7.4e-66	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000110687
AA Change: E484G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000106315
Gene: ENSMUSG00000021027
AA Change: E484G

Domain	Start	End	E-Value	Type
low complexity region	644	651	N/A	INTRINSIC
low complexity region	676	690	N/A	INTRINSIC
low complexity region	692	704	N/A	INTRINSIC
low complexity region	894	915	N/A	INTRINSIC
low complexity region	1386	1395	N/A	INTRINSIC
low complexity region	1784	1798	N/A	INTRINSIC
Pfam:Rap_GAP	1824	2001	1.9e-48	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000219432
AA Change: E484G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000220367
AA Change: E484G

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)

Predicted Effect

probably benign
Transcript: ENSMUST00000226244
AA Change: E484G

PolyPhen 2 Score 0.393 (Sensitivity: 0.90; Specificity: 0.89)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a major subunit of the RAL-GTPase activating protein. A similar protein in mouse binds E12, a transcriptional regulator of immunoglobulin genes. The mouse protein also functions in skeletal muscle by binding to the regulatory 14-3-3 proteins upon stimulation with insulin or muscle contraction. A pseudogene of this gene has been identified on chromosome 9. [provided by RefSeq, Oct 2016]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	A	G	2: 69,265,675	I804T	probably benign	Het
Abcb1b	A	T	5: 8,805,441	E25V	probably damaging	Het
Adamts9	G	T	6: 92,909,793	Y355*	probably null	Het
Akp3	A	G	1: 87,126,778	M303V	probably benign	Het
Ankrd35	A	T	3: 96,683,334	E312V	possibly damaging	Het
Arhgap40	T	C	2: 158,531,374		probably null	Het
Asxl1	T	C	2: 153,400,107	L859P	probably benign	Het
Atat1	A	G	17: 35,910,005	F11L	probably benign	Het
Bach1	G	A	16: 87,719,291	R240Q	probably benign	Het
Ccdc7a	A	T	8: 128,881,594	H943Q	unknown	Het
Cep135	A	G	5: 76,616,848	T558A	probably benign	Het
Cfap99	A	G	5: 34,301,519	E86G	possibly damaging	Het
Cfhr2	C	T	1: 139,831,063		probably null	Het
Cmtm1	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	8: 104,309,470		probably benign	Het
Col17a1	G	A	19: 47,652,183	P992L	probably damaging	Het
Col7a1	C	T	9: 108,963,263	Q1294*	probably null	Het
Coq8b	T	A	7: 27,239,868	C148S	probably damaging	Het
Csmd2	A	G	4: 128,277,228	N338S		Het
Cspg5	T	A	9: 110,246,891	S232T	possibly damaging	Het
Cyp2c67	A	G	19: 39,639,897	V201A	possibly damaging	Het
Dlgap3	G	A	4: 127,195,517	R302H	possibly damaging	Het
Dpy19l2	T	C	9: 24,628,251	I469V	probably benign	Het
Fam135b	T	C	15: 71,471,563	D401G	probably damaging	Het
Gabbr1	G	T	17: 37,064,737	G453*	probably null	Het
Gclc	C	A	9: 77,788,216	A440D	probably damaging	Het
Glyat	T	C	19: 12,650,359	I106T	probably benign	Het
Gm12185	T	C	11: 48,908,244	N474S	possibly damaging	Het
Gm17079	T	C	14: 51,693,037	H117R		Het
Gm884	C	T	11: 103,614,537	A26T	probably benign	Het
Ildr2	A	G	1: 166,303,529	D318G	probably damaging	Het
Kcnd2	G	A	6: 21,216,178		probably benign	Het
Kif19a	C	T	11: 114,781,208	T207M	probably damaging	Het
Kif3a	G	T	11: 53,586,906	G401*	probably null	Het
Lactbl1	T	A	4: 136,632,975	L155Q	probably damaging	Het
Lrp1b	T	A	2: 41,246,011	D1649V	probably benign	Het
Map2k1	A	G	9: 64,193,823	V191A	probably benign	Het
Mdm4	A	T	1: 133,003,809	C165S	probably benign	Het
Med27	G	A	2: 29,509,434	W92*	probably null	Het
Muc20	A	T	16: 32,794,246	S254T	probably benign	Het
Myh1	A	G	11: 67,220,421	E1562G	possibly damaging	Het
Nlrp2	C	G	7: 5,328,572	R275P	possibly damaging	Het
Notch2	T	A	3: 98,102,387	N543K	probably damaging	Het
Nup214	T	A	2: 32,034,156	S1566T	probably benign	Het
Nxnl1	T	G	8: 71,562,793	E157A	possibly damaging	Het
Obscn	A	G	11: 59,079,133	L61P	probably damaging	Het
Ogg1	A	T	6: 113,329,276	I145F	probably damaging	Het
Olfr1359	A	G	13: 21,703,270	K90E	possibly damaging	Het
Olfr453	G	A	6: 42,744,403	R122H	probably benign	Het
Olfr572	T	C	7: 102,927,942	F105L	probably damaging	Het
Olfr976	T	C	9: 39,956,345	T197A	probably benign	Het
Pclo	A	G	5: 14,713,447	D3978G	unknown	Het
Pla2g4e	T	G	2: 120,170,195	D687A	probably damaging	Het
Pla2r1	T	C	2: 60,458,393	K632E	probably damaging	Het
Plg	A	T	17: 12,391,836	Q212L	probably damaging	Het
Poldip3	A	T	15: 83,131,497	N306K	probably damaging	Het
Pspn	A	G	17: 56,999,978	L13P	possibly damaging	Het
Rbmxl1	G	T	8: 78,506,657	T19K	probably damaging	Het
Rora	G	A	9: 69,196,083	V31I	possibly damaging	Het
Skint5	C	A	4: 113,940,839	W182C	probably damaging	Het
Spata31d1c	A	T	13: 65,036,063	Q473L	probably damaging	Het
Tesk2	G	A	4: 116,802,687	W334*	probably null	Het
Tmem67	C	A	4: 12,075,484	V277L	probably benign	Het
Trhde	A	G	10: 114,518,177	M537T	probably damaging	Het
Ttc30a2	A	T	2: 75,976,269	L633*	probably null	Het
Tubb6	G	A	18: 67,401,911	M293I	probably benign	Het
Ube2ql1	A	T	13: 69,738,754	L196Q	probably damaging	Het
Ubn1	A	T	16: 5,055,324	N70I	probably damaging	Het
Ubtf	A	T	11: 102,314,980	S40T	probably benign	Het
Virma	C	T	4: 11,519,249	A782V	possibly damaging	Het
Xdh	G	T	17: 73,943,873	T28K	probably damaging	Het
Xpo4	A	G	14: 57,597,051	S691P	probably benign	Het
Zfat	A	C	15: 68,180,452	F491V	probably damaging	Het
Zfp623	T	G	15: 75,948,305	V370G	probably damaging	Het

Other mutations in Ralgapa1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Ralgapa1	APN	12	55722773	missense	probably damaging	0.98
IGL00494:Ralgapa1	APN	12	55747185	missense	probably damaging	1.00
IGL00731:Ralgapa1	APN	12	55702452	missense	possibly damaging	0.94
IGL00851:Ralgapa1	APN	12	55709575	missense	possibly damaging	0.93
IGL01133:Ralgapa1	APN	12	55642348	missense	probably damaging	1.00
IGL01133:Ralgapa1	APN	12	55642359	missense	probably damaging	0.99
IGL01354:Ralgapa1	APN	12	55777316	missense	possibly damaging	0.68
IGL01514:Ralgapa1	APN	12	55719657	missense	probably damaging	0.97
IGL02033:Ralgapa1	APN	12	55642477	missense	possibly damaging	0.69
IGL02064:Ralgapa1	APN	12	55708077	missense	probably damaging	1.00
IGL02556:Ralgapa1	APN	12	55642449	missense	possibly damaging	0.80
IGL02605:Ralgapa1	APN	12	55712665	missense	possibly damaging	0.90
IGL02657:Ralgapa1	APN	12	55673507	missense	probably damaging	1.00
IGL02676:Ralgapa1	APN	12	55676417	missense	probably damaging	1.00
IGL02894:Ralgapa1	APN	12	55717069	missense	possibly damaging	0.79
IGL02944:Ralgapa1	APN	12	55757951	missense	probably benign	0.01
Anhydrous	UTSW	12	55795778	critical splice acceptor site	probably null
Aqueous	UTSW	12	55698854	missense	probably damaging	1.00
bantam	UTSW	12	55722773	critical splice donor site	probably null
Deliquescent	UTSW	12	55782900	splice site	probably benign
wickedwarlock	UTSW	12	55777292	missense	probably null	0.99
F5770:Ralgapa1	UTSW	12	55795653	splice site	probably benign
IGL03046:Ralgapa1	UTSW	12	55695157	missense	probably damaging	1.00
R0011:Ralgapa1	UTSW	12	55786263	missense	probably damaging	0.99
R0096:Ralgapa1	UTSW	12	55739505	missense	probably damaging	1.00
R0277:Ralgapa1	UTSW	12	55677238	missense	probably damaging	0.99
R0323:Ralgapa1	UTSW	12	55677238	missense	probably damaging	0.99
R0333:Ralgapa1	UTSW	12	55782900	splice site	probably benign
R0361:Ralgapa1	UTSW	12	55676569	missense	possibly damaging	0.93
R0385:Ralgapa1	UTSW	12	55677038	missense	probably damaging	1.00
R0386:Ralgapa1	UTSW	12	55708067	missense	probably benign	0.03
R0498:Ralgapa1	UTSW	12	55689791	missense	possibly damaging	0.66
R0552:Ralgapa1	UTSW	12	55676765	missense	probably benign	0.27
R0564:Ralgapa1	UTSW	12	55782885	missense	possibly damaging	0.84
R0611:Ralgapa1	UTSW	12	55795698	missense	probably damaging	0.99
R0730:Ralgapa1	UTSW	12	55665663	missense	probably damaging	1.00
R0741:Ralgapa1	UTSW	12	55676581	missense	probably damaging	0.99
R0815:Ralgapa1	UTSW	12	55762681	nonsense	probably null
R0815:Ralgapa1	UTSW	12	55782777	splice site	probably benign
R0863:Ralgapa1	UTSW	12	55762681	nonsense	probably null
R0863:Ralgapa1	UTSW	12	55782777	splice site	probably benign
R1068:Ralgapa1	UTSW	12	55790310	critical splice donor site	probably null
R1147:Ralgapa1	UTSW	12	55702480	missense	probably damaging	1.00
R1147:Ralgapa1	UTSW	12	55702480	missense	probably damaging	1.00
R1256:Ralgapa1	UTSW	12	55762661	missense	possibly damaging	0.94
R1343:Ralgapa1	UTSW	12	55707978	missense	probably damaging	1.00
R1378:Ralgapa1	UTSW	12	55676926	missense	probably damaging	1.00
R1474:Ralgapa1	UTSW	12	55741480	missense	probably benign	0.09
R1494:Ralgapa1	UTSW	12	55684524	missense	probably damaging	0.99
R1593:Ralgapa1	UTSW	12	55770703	missense	probably damaging	1.00
R1607:Ralgapa1	UTSW	12	55741536	missense	probably damaging	1.00
R1681:Ralgapa1	UTSW	12	55762603	missense	probably benign	0.35
R1689:Ralgapa1	UTSW	12	55676767	missense	possibly damaging	0.79
R1714:Ralgapa1	UTSW	12	55642389	missense	probably damaging	1.00
R1832:Ralgapa1	UTSW	12	55757967	missense	probably benign	0.03
R1870:Ralgapa1	UTSW	12	55677032	missense	possibly damaging	0.66
R2040:Ralgapa1	UTSW	12	55786322	missense	probably damaging	1.00
R2043:Ralgapa1	UTSW	12	55677026	missense	probably damaging	0.99
R2046:Ralgapa1	UTSW	12	55695160	missense	probably damaging	1.00
R2109:Ralgapa1	UTSW	12	55776188	missense	possibly damaging	0.90
R2114:Ralgapa1	UTSW	12	55786349	critical splice acceptor site	probably null
R2115:Ralgapa1	UTSW	12	55786349	critical splice acceptor site	probably null
R2202:Ralgapa1	UTSW	12	55612800	splice site	probably null
R2203:Ralgapa1	UTSW	12	55612800	splice site	probably null
R2233:Ralgapa1	UTSW	12	55717071	missense	probably benign	0.13
R2235:Ralgapa1	UTSW	12	55717071	missense	probably benign	0.13
R2341:Ralgapa1	UTSW	12	55677124	missense	possibly damaging	0.66
R2507:Ralgapa1	UTSW	12	55718201	missense	probably damaging	1.00
R2508:Ralgapa1	UTSW	12	55718201	missense	probably damaging	1.00
R2972:Ralgapa1	UTSW	12	55820755	missense	possibly damaging	0.61
R3160:Ralgapa1	UTSW	12	55709586	missense	probably damaging	1.00
R3162:Ralgapa1	UTSW	12	55709586	missense	probably damaging	1.00
R3401:Ralgapa1	UTSW	12	55659137	missense	possibly damaging	0.66
R3416:Ralgapa1	UTSW	12	55770613	splice site	probably benign
R3499:Ralgapa1	UTSW	12	55695143	splice site	probably benign
R3799:Ralgapa1	UTSW	12	55659130	missense	probably damaging	1.00
R3948:Ralgapa1	UTSW	12	55698767	missense	probably damaging	1.00
R4039:Ralgapa1	UTSW	12	55795701	missense	probably damaging	0.99
R4120:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4165:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4166:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4212:Ralgapa1	UTSW	12	55739330	critical splice donor site	probably null
R4232:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4233:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4234:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4235:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4399:Ralgapa1	UTSW	12	55795778	critical splice acceptor site	probably null
R4698:Ralgapa1	UTSW	12	55677276	splice site	probably null
R4715:Ralgapa1	UTSW	12	55693458	missense	probably damaging	1.00
R4755:Ralgapa1	UTSW	12	55712748	missense	probably damaging	1.00
R4810:Ralgapa1	UTSW	12	55794993	critical splice donor site	probably null
R4827:Ralgapa1	UTSW	12	55676437	missense	probably damaging	1.00
R4849:Ralgapa1	UTSW	12	55698803	missense	probably damaging	0.99
R4934:Ralgapa1	UTSW	12	55762574	missense	possibly damaging	0.94
R5006:Ralgapa1	UTSW	12	55718114	missense	probably benign	0.02
R5114:Ralgapa1	UTSW	12	55612723	missense	possibly damaging	0.84
R5140:Ralgapa1	UTSW	12	55776152	missense	probably damaging	1.00
R5140:Ralgapa1	UTSW	12	55665674	missense	probably damaging	1.00
R5168:Ralgapa1	UTSW	12	55758032	missense	probably benign	0.05
R5407:Ralgapa1	UTSW	12	55676797	missense	possibly damaging	0.93
R5441:Ralgapa1	UTSW	12	55719623	missense	probably damaging	1.00
R5473:Ralgapa1	UTSW	12	55676710	missense	probably benign	0.41
R5624:Ralgapa1	UTSW	12	55612738	missense	probably damaging	1.00
R5766:Ralgapa1	UTSW	12	55820766	start codon destroyed	probably null	0.99
R5826:Ralgapa1	UTSW	12	55677113	missense	probably damaging	1.00
R5950:Ralgapa1	UTSW	12	55738265	missense	possibly damaging	0.58
R5980:Ralgapa1	UTSW	12	55770616	splice site	probably null
R6019:Ralgapa1	UTSW	12	55684042	missense	possibly damaging	0.92
R6065:Ralgapa1	UTSW	12	55757924	critical splice donor site	probably null
R6326:Ralgapa1	UTSW	12	55747146	missense	probably damaging	1.00
R6355:Ralgapa1	UTSW	12	55698854	missense	probably damaging	1.00
R6408:Ralgapa1	UTSW	12	55683910	nonsense	probably null
R6448:Ralgapa1	UTSW	12	55719661	missense	probably benign	0.14
R6453:Ralgapa1	UTSW	12	55738319	missense	probably damaging	1.00
R6590:Ralgapa1	UTSW	12	55722773	critical splice donor site	probably null
R6690:Ralgapa1	UTSW	12	55722773	critical splice donor site	probably null
R6738:Ralgapa1	UTSW	12	55762727	missense	probably damaging	1.00
R6836:Ralgapa1	UTSW	12	55604273	splice site	probably null
R6936:Ralgapa1	UTSW	12	55786212	missense	probably damaging	0.99
R6945:Ralgapa1	UTSW	12	55776191	missense	possibly damaging	0.64
R7075:Ralgapa1	UTSW	12	55820723	missense	possibly damaging	0.66
R7076:Ralgapa1	UTSW	12	55721576	missense	possibly damaging	0.82
R7098:Ralgapa1	UTSW	12	55790310	critical splice donor site	probably null
R7231:Ralgapa1	UTSW	12	55604191	missense	probably damaging	1.00
R7254:Ralgapa1	UTSW	12	55695193	missense	probably damaging	1.00
R7326:Ralgapa1	UTSW	12	55709004	missense	probably damaging	1.00
R7485:Ralgapa1	UTSW	12	55712672	missense	probably damaging	1.00
R7580:Ralgapa1	UTSW	12	55718228	missense	probably benign	0.00
R7677:Ralgapa1	UTSW	12	55659143	missense	probably damaging	0.96
R7702:Ralgapa1	UTSW	12	55709555	missense	probably damaging	1.00
R7702:Ralgapa1	UTSW	12	55709556	missense	probably damaging	1.00
R7707:Ralgapa1	UTSW	12	55777292	missense	probably null	0.99
R7723:Ralgapa1	UTSW	12	55741513	missense	probably benign
R7763:Ralgapa1	UTSW	12	55757955	missense	probably benign	0.28
R7791:Ralgapa1	UTSW	12	55741519	missense	probably damaging	0.97
R7812:Ralgapa1	UTSW	12	55719628	missense	possibly damaging	0.67
R7868:Ralgapa1	UTSW	12	55612638	missense	probably benign	0.00
R7895:Ralgapa1	UTSW	12	55747149	missense	probably benign	0.44
R7896:Ralgapa1	UTSW	12	55697878	missense	probably benign	0.01
R8004:Ralgapa1	UTSW	12	55702457	missense	probably damaging	0.99
R8094:Ralgapa1	UTSW	12	55782846	missense	probably damaging	0.99
R8213:Ralgapa1	UTSW	12	55722914	missense	probably damaging	0.99
R8307:Ralgapa1	UTSW	12	55741523	missense	probably damaging	0.99
R8423:Ralgapa1	UTSW	12	55659062	missense	probably damaging	0.99
R8462:Ralgapa1	UTSW	12	55676518	missense	possibly damaging	0.90
R8469:Ralgapa1	UTSW	12	55739413	missense	probably damaging	1.00
R8675:Ralgapa1	UTSW	12	55738217	missense	possibly damaging	0.93
R8802:Ralgapa1	UTSW	12	55738316	missense	probably damaging	0.99
R8937:Ralgapa1	UTSW	12	55702560	missense	probably damaging	0.96
R8953:Ralgapa1	UTSW	12	55820761	missense	probably damaging	0.99
R8974:Ralgapa1	UTSW	12	55677006	missense	probably benign
R9011:Ralgapa1	UTSW	12	55605529	intron	probably benign
R9089:Ralgapa1	UTSW	12	55676566	missense	probably damaging	0.97
R9124:Ralgapa1	UTSW	12	55735096	missense	probably damaging	1.00
R9254:Ralgapa1	UTSW	12	55722798	missense	probably damaging	1.00
R9320:Ralgapa1	UTSW	12	55709058	missense	possibly damaging	0.59
R9379:Ralgapa1	UTSW	12	55722798	missense	probably damaging	1.00
R9446:Ralgapa1	UTSW	12	55708023	missense	probably damaging	0.97
R9684:Ralgapa1	UTSW	12	55612700	missense	possibly damaging	0.63
Z1176:Ralgapa1	UTSW	12	55709080	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAATCCCAAAGTATAGGCATTTGAAC -3'
(R):5'- TTACAGACTTCACGCCTGAG -3'

Sequencing Primer
(F):5'- AGAGAACTTGCCTTGCATGC -3'
(R):5'- AGACTTCACGCCTGAGTCATC -3'

Posted On

2019-05-13