Incidental Mutation 'R7028:Spata31d1c'
ID546147
Institutional Source Beutler Lab
Gene Symbol Spata31d1c
Ensembl Gene ENSMUSG00000074849
Gene Namespermatogenesis associated 31 subfamily D, member 1C
Synonyms4932441B19Rik, Fam75d1c
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7028 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location65033058-65038004 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65036063 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 473 (Q473L)
Ref Sequence ENSEMBL: ENSMUSP00000097024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099427]
Predicted Effect probably damaging
Transcript: ENSMUST00000099427
AA Change: Q473L

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000097024
Gene: ENSMUSG00000074849
AA Change: Q473L

DomainStartEndE-ValueType
transmembrane domain 22 44 N/A INTRINSIC
Pfam:DUF4599 63 148 2.4e-31 PFAM
low complexity region 178 190 N/A INTRINSIC
low complexity region 196 213 N/A INTRINSIC
low complexity region 218 233 N/A INTRINSIC
low complexity region 237 251 N/A INTRINSIC
Pfam:FAM75 380 742 1.4e-120 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A G 2: 69,265,675 I804T probably benign Het
Abcb1b A T 5: 8,805,441 E25V probably damaging Het
Adamts9 G T 6: 92,909,793 Y355* probably null Het
Akp3 A G 1: 87,126,778 M303V probably benign Het
Ankrd35 A T 3: 96,683,334 E312V possibly damaging Het
Arhgap40 T C 2: 158,531,374 probably null Het
Asxl1 T C 2: 153,400,107 L859P probably benign Het
Atat1 A G 17: 35,910,005 F11L probably benign Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Ccdc7a A T 8: 128,881,594 H943Q unknown Het
Cep135 A G 5: 76,616,848 T558A probably benign Het
Cfap99 A G 5: 34,301,519 E86G possibly damaging Het
Cfhr2 C T 1: 139,831,063 probably null Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Col17a1 G A 19: 47,652,183 P992L probably damaging Het
Col7a1 C T 9: 108,963,263 Q1294* probably null Het
Coq8b T A 7: 27,239,868 C148S probably damaging Het
Csmd2 A G 4: 128,277,228 N338S Het
Cspg5 T A 9: 110,246,891 S232T possibly damaging Het
Cyp2c67 A G 19: 39,639,897 V201A possibly damaging Het
Dlgap3 G A 4: 127,195,517 R302H possibly damaging Het
Dpy19l2 T C 9: 24,628,251 I469V probably benign Het
Fam135b T C 15: 71,471,563 D401G probably damaging Het
Gabbr1 G T 17: 37,064,737 G453* probably null Het
Gclc C A 9: 77,788,216 A440D probably damaging Het
Glyat T C 19: 12,650,359 I106T probably benign Het
Gm12185 T C 11: 48,908,244 N474S possibly damaging Het
Gm17079 T C 14: 51,693,037 H117R Het
Gm884 C T 11: 103,614,537 A26T probably benign Het
Ildr2 A G 1: 166,303,529 D318G probably damaging Het
Kcnd2 G A 6: 21,216,178 probably benign Het
Kif19a C T 11: 114,781,208 T207M probably damaging Het
Kif3a G T 11: 53,586,906 G401* probably null Het
Lactbl1 T A 4: 136,632,975 L155Q probably damaging Het
Lrp1b T A 2: 41,246,011 D1649V probably benign Het
Map2k1 A G 9: 64,193,823 V191A probably benign Het
Mdm4 A T 1: 133,003,809 C165S probably benign Het
Med27 G A 2: 29,509,434 W92* probably null Het
Muc20 A T 16: 32,794,246 S254T probably benign Het
Myh1 A G 11: 67,220,421 E1562G possibly damaging Het
Nlrp2 C G 7: 5,328,572 R275P possibly damaging Het
Notch2 T A 3: 98,102,387 N543K probably damaging Het
Nup214 T A 2: 32,034,156 S1566T probably benign Het
Nxnl1 T G 8: 71,562,793 E157A possibly damaging Het
Obscn A G 11: 59,079,133 L61P probably damaging Het
Ogg1 A T 6: 113,329,276 I145F probably damaging Het
Olfr1359 A G 13: 21,703,270 K90E possibly damaging Het
Olfr453 G A 6: 42,744,403 R122H probably benign Het
Olfr572 T C 7: 102,927,942 F105L probably damaging Het
Olfr976 T C 9: 39,956,345 T197A probably benign Het
Pclo A G 5: 14,713,447 D3978G unknown Het
Pla2g4e T G 2: 120,170,195 D687A probably damaging Het
Pla2r1 T C 2: 60,458,393 K632E probably damaging Het
Plg A T 17: 12,391,836 Q212L probably damaging Het
Poldip3 A T 15: 83,131,497 N306K probably damaging Het
Pspn A G 17: 56,999,978 L13P possibly damaging Het
Ralgapa1 T C 12: 55,758,059 E484G probably damaging Het
Rbmxl1 G T 8: 78,506,657 T19K probably damaging Het
Rora G A 9: 69,196,083 V31I possibly damaging Het
Skint5 C A 4: 113,940,839 W182C probably damaging Het
Tesk2 G A 4: 116,802,687 W334* probably null Het
Tmem67 C A 4: 12,075,484 V277L probably benign Het
Trhde A G 10: 114,518,177 M537T probably damaging Het
Ttc30a2 A T 2: 75,976,269 L633* probably null Het
Tubb6 G A 18: 67,401,911 M293I probably benign Het
Ube2ql1 A T 13: 69,738,754 L196Q probably damaging Het
Ubn1 A T 16: 5,055,324 N70I probably damaging Het
Ubtf A T 11: 102,314,980 S40T probably benign Het
Virma C T 4: 11,519,249 A782V possibly damaging Het
Xdh G T 17: 73,943,873 T28K probably damaging Het
Xpo4 A G 14: 57,597,051 S691P probably benign Het
Zfat A C 15: 68,180,452 F491V probably damaging Het
Zfp623 T G 15: 75,948,305 V370G probably damaging Het
Other mutations in Spata31d1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01639:Spata31d1c APN 13 65036089 missense probably damaging 1.00
IGL02830:Spata31d1c APN 13 65035366 missense probably benign 0.25
IGL02947:Spata31d1c APN 13 65034945 nonsense probably null
IGL03133:Spata31d1c APN 13 65034985 missense probably benign 0.18
IGL03176:Spata31d1c APN 13 65037011 missense probably benign 0.01
IGL03183:Spata31d1c APN 13 65035195 missense possibly damaging 0.86
IGL03206:Spata31d1c APN 13 65035593 missense probably benign 0.41
PIT4382001:Spata31d1c UTSW 13 65036171 missense probably benign 0.01
R0054:Spata31d1c UTSW 13 65033062 start gained probably benign
R0959:Spata31d1c UTSW 13 65036315 missense probably damaging 1.00
R1232:Spata31d1c UTSW 13 65036614 missense probably benign
R1347:Spata31d1c UTSW 13 65035388 missense probably benign 0.00
R1381:Spata31d1c UTSW 13 65036554 missense probably benign 0.08
R1573:Spata31d1c UTSW 13 65035069 missense possibly damaging 0.92
R1582:Spata31d1c UTSW 13 65033224 missense probably benign
R1639:Spata31d1c UTSW 13 65036039 missense probably benign
R1716:Spata31d1c UTSW 13 65033216 missense possibly damaging 0.86
R1781:Spata31d1c UTSW 13 65036171 missense probably benign 0.01
R1907:Spata31d1c UTSW 13 65035876 missense probably benign 0.03
R2012:Spata31d1c UTSW 13 65035227 missense possibly damaging 0.91
R2152:Spata31d1c UTSW 13 65033965 critical splice donor site probably null
R2211:Spata31d1c UTSW 13 65035939 missense probably benign 0.04
R2571:Spata31d1c UTSW 13 65036384 missense probably damaging 1.00
R2908:Spata31d1c UTSW 13 65033191 missense possibly damaging 0.63
R3978:Spata31d1c UTSW 13 65035160 missense possibly damaging 0.61
R3979:Spata31d1c UTSW 13 65035160 missense possibly damaging 0.61
R3980:Spata31d1c UTSW 13 65035160 missense possibly damaging 0.61
R3981:Spata31d1c UTSW 13 65035111 missense possibly damaging 0.68
R4014:Spata31d1c UTSW 13 65035399 missense probably damaging 0.99
R4255:Spata31d1c UTSW 13 65035688 nonsense probably null
R4255:Spata31d1c UTSW 13 65035717 missense probably benign 0.04
R4592:Spata31d1c UTSW 13 65036060 missense probably damaging 0.99
R4597:Spata31d1c UTSW 13 65035613 nonsense probably null
R4624:Spata31d1c UTSW 13 65036597 missense probably benign
R4641:Spata31d1c UTSW 13 65035048 missense probably benign 0.01
R4863:Spata31d1c UTSW 13 65035790 nonsense probably null
R5084:Spata31d1c UTSW 13 65035130 missense probably damaging 0.98
R5152:Spata31d1c UTSW 13 65035595 missense probably damaging 1.00
R5230:Spata31d1c UTSW 13 65035434 missense probably benign 0.41
R5267:Spata31d1c UTSW 13 65035904 missense probably damaging 0.98
R5615:Spata31d1c UTSW 13 65035264 missense possibly damaging 0.61
R5755:Spata31d1c UTSW 13 65036527 missense probably benign 0.12
R5935:Spata31d1c UTSW 13 65037080 missense possibly damaging 0.68
R6017:Spata31d1c UTSW 13 65035079 missense possibly damaging 0.91
R6131:Spata31d1c UTSW 13 65035671 missense probably benign 0.10
R6359:Spata31d1c UTSW 13 65035592 missense possibly damaging 0.63
R6723:Spata31d1c UTSW 13 65035944 missense probably benign 0.01
R7336:Spata31d1c UTSW 13 65036128 missense probably damaging 0.99
R7426:Spata31d1c UTSW 13 65035361 missense probably benign
R7552:Spata31d1c UTSW 13 65036123 missense probably damaging 0.98
R7605:Spata31d1c UTSW 13 65035840 missense probably benign 0.00
R7666:Spata31d1c UTSW 13 65036000 missense probably benign 0.01
R8403:Spata31d1c UTSW 13 65036230 missense probably benign 0.42
R8445:Spata31d1c UTSW 13 65033177 missense probably damaging 0.98
R8513:Spata31d1c UTSW 13 65033177 missense probably damaging 0.98
R8515:Spata31d1c UTSW 13 65033177 missense probably damaging 0.98
R8523:Spata31d1c UTSW 13 65033177 missense probably damaging 0.98
R8799:Spata31d1c UTSW 13 65036326 missense possibly damaging 0.92
R8817:Spata31d1c UTSW 13 65034562 missense probably damaging 0.98
R8854:Spata31d1c UTSW 13 65035990 missense possibly damaging 0.82
R8917:Spata31d1c UTSW 13 65035615 missense probably benign 0.02
X0022:Spata31d1c UTSW 13 65036927 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- GTGTTGACTGACAGTTCCCTG -3'
(R):5'- CTGACTGACCAATGAGGGATTAGG -3'

Sequencing Primer
(F):5'- GATCTCTGGGTGCTTCAACAGATTC -3'
(R):5'- GAATTTATGACCACAGTGGGTAAACC -3'
Posted On2019-05-13