Incidental Mutation 'R7028:Poldip3'
ID 546154
Institutional Source Beutler Lab
Gene Symbol Poldip3
Ensembl Gene ENSMUSG00000041815
Gene Name polymerase (DNA-directed), delta interacting protein 3
Synonyms 1110008P04Rik, PDIP46
MMRRC Submission 045129-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.185) question?
Stock # R7028 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 83010177-83033585 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 83015698 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 306 (N306K)
Ref Sequence ENSEMBL: ENSMUSP00000097944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058793] [ENSMUST00000100375] [ENSMUST00000129372]
AlphaFold Q8BG81
Predicted Effect probably damaging
Transcript: ENSMUST00000058793
AA Change: N335K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054548
Gene: ENSMUSG00000041815
AA Change: N335K

DomainStartEndE-ValueType
low complexity region 183 196 N/A INTRINSIC
low complexity region 214 223 N/A INTRINSIC
low complexity region 260 272 N/A INTRINSIC
RRM 281 347 5.05e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100375
AA Change: N306K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097944
Gene: ENSMUSG00000041815
AA Change: N306K

DomainStartEndE-ValueType
low complexity region 154 167 N/A INTRINSIC
low complexity region 185 194 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
RRM 252 318 5.05e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129372
SMART Domains Protein: ENSMUSP00000120859
Gene: ENSMUSG00000041815

DomainStartEndE-ValueType
low complexity region 153 162 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RRM (RNA recognition motif)-containing protein that participates in the regulation of translation by recruiting ribosomal protein S6 kinase beta-1 to mRNAs. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A G 2: 69,096,019 (GRCm39) I804T probably benign Het
Abcb1b A T 5: 8,855,441 (GRCm39) E25V probably damaging Het
Adamts9 G T 6: 92,886,774 (GRCm39) Y355* probably null Het
Akp3 A G 1: 87,054,500 (GRCm39) M303V probably benign Het
Ankrd35 A T 3: 96,590,650 (GRCm39) E312V possibly damaging Het
Arhgap40 T C 2: 158,373,294 (GRCm39) probably null Het
Asxl1 T C 2: 153,242,027 (GRCm39) L859P probably benign Het
Atat1 A G 17: 36,220,897 (GRCm39) F11L probably benign Het
Bach1 G A 16: 87,516,179 (GRCm39) R240Q probably benign Het
Ccdc7a A T 8: 129,608,075 (GRCm39) H943Q unknown Het
Cep135 A G 5: 76,764,695 (GRCm39) T558A probably benign Het
Cfap99 A G 5: 34,458,863 (GRCm39) E86G possibly damaging Het
Cfhr2 C T 1: 139,758,801 (GRCm39) probably null Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 105,036,102 (GRCm39) probably benign Het
Col17a1 G A 19: 47,640,622 (GRCm39) P992L probably damaging Het
Col7a1 C T 9: 108,792,331 (GRCm39) Q1294* probably null Het
Coq8b T A 7: 26,939,293 (GRCm39) C148S probably damaging Het
Csmd2 A G 4: 128,171,021 (GRCm39) N338S Het
Cspg5 T A 9: 110,075,959 (GRCm39) S232T possibly damaging Het
Cyp2c67 A G 19: 39,628,341 (GRCm39) V201A possibly damaging Het
Dlgap3 G A 4: 127,089,310 (GRCm39) R302H possibly damaging Het
Dpy19l2 T C 9: 24,539,547 (GRCm39) I469V probably benign Het
Fam135b T C 15: 71,343,412 (GRCm39) D401G probably damaging Het
Gabbr1 G T 17: 37,375,629 (GRCm39) G453* probably null Het
Gclc C A 9: 77,695,498 (GRCm39) A440D probably damaging Het
Glyat T C 19: 12,627,723 (GRCm39) I106T probably benign Het
Gm12185 T C 11: 48,799,071 (GRCm39) N474S possibly damaging Het
Gm17079 T C 14: 51,930,494 (GRCm39) H117R Het
Ift70a2 A T 2: 75,806,613 (GRCm39) L633* probably null Het
Ildr2 A G 1: 166,131,098 (GRCm39) D318G probably damaging Het
Kcnd2 G A 6: 21,216,177 (GRCm39) probably benign Het
Kif19a C T 11: 114,672,034 (GRCm39) T207M probably damaging Het
Kif3a G T 11: 53,477,733 (GRCm39) G401* probably null Het
Lactbl1 T A 4: 136,360,286 (GRCm39) L155Q probably damaging Het
Lrp1b T A 2: 41,136,023 (GRCm39) D1649V probably benign Het
Lrrc37 C T 11: 103,505,363 (GRCm39) A26T probably benign Het
Map2k1 A G 9: 64,101,105 (GRCm39) V191A probably benign Het
Mdm4 A T 1: 132,931,547 (GRCm39) C165S probably benign Het
Med27 G A 2: 29,399,446 (GRCm39) W92* probably null Het
Muc20 A T 16: 32,614,616 (GRCm39) S254T probably benign Het
Myh1 A G 11: 67,111,247 (GRCm39) E1562G possibly damaging Het
Nlrp2 C G 7: 5,331,571 (GRCm39) R275P possibly damaging Het
Notch2 T A 3: 98,009,703 (GRCm39) N543K probably damaging Het
Nup214 T A 2: 31,924,168 (GRCm39) S1566T probably benign Het
Nxnl1 T G 8: 72,015,437 (GRCm39) E157A possibly damaging Het
Obscn A G 11: 58,969,959 (GRCm39) L61P probably damaging Het
Ogg1 A T 6: 113,306,237 (GRCm39) I145F probably damaging Het
Or10d5j T C 9: 39,867,641 (GRCm39) T197A probably benign Het
Or2b2 A G 13: 21,887,440 (GRCm39) K90E possibly damaging Het
Or2f1 G A 6: 42,721,337 (GRCm39) R122H probably benign Het
Or51h5 T C 7: 102,577,149 (GRCm39) F105L probably damaging Het
Pclo A G 5: 14,763,461 (GRCm39) D3978G unknown Het
Pla2g4e T G 2: 120,000,676 (GRCm39) D687A probably damaging Het
Pla2r1 T C 2: 60,288,737 (GRCm39) K632E probably damaging Het
Plg A T 17: 12,610,723 (GRCm39) Q212L probably damaging Het
Pspn A G 17: 57,306,978 (GRCm39) L13P possibly damaging Het
Ralgapa1 T C 12: 55,804,844 (GRCm39) E484G probably damaging Het
Rbmxl1 G T 8: 79,233,286 (GRCm39) T19K probably damaging Het
Rora G A 9: 69,103,365 (GRCm39) V31I possibly damaging Het
Skint5 C A 4: 113,798,036 (GRCm39) W182C probably damaging Het
Spata31d1c A T 13: 65,183,877 (GRCm39) Q473L probably damaging Het
Tesk2 G A 4: 116,659,884 (GRCm39) W334* probably null Het
Tmem67 C A 4: 12,075,484 (GRCm39) V277L probably benign Het
Trhde A G 10: 114,354,082 (GRCm39) M537T probably damaging Het
Tubb6 G A 18: 67,534,981 (GRCm39) M293I probably benign Het
Ube2ql1 A T 13: 69,886,873 (GRCm39) L196Q probably damaging Het
Ubn1 A T 16: 4,873,188 (GRCm39) N70I probably damaging Het
Ubtf A T 11: 102,205,806 (GRCm39) S40T probably benign Het
Virma C T 4: 11,519,249 (GRCm39) A782V possibly damaging Het
Xdh G T 17: 74,250,868 (GRCm39) T28K probably damaging Het
Xpo4 A G 14: 57,834,508 (GRCm39) S691P probably benign Het
Zfat A C 15: 68,052,301 (GRCm39) F491V probably damaging Het
Zfp623 T G 15: 75,820,154 (GRCm39) V370G probably damaging Het
Other mutations in Poldip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Poldip3 APN 15 83,022,680 (GRCm39) missense probably damaging 1.00
IGL02887:Poldip3 APN 15 83,013,469 (GRCm39) unclassified probably benign
R0143:Poldip3 UTSW 15 83,012,144 (GRCm39) missense probably damaging 1.00
R0201:Poldip3 UTSW 15 83,019,497 (GRCm39) missense probably benign 0.00
R0511:Poldip3 UTSW 15 83,022,436 (GRCm39) missense probably damaging 1.00
R1560:Poldip3 UTSW 15 83,022,527 (GRCm39) missense probably damaging 1.00
R2302:Poldip3 UTSW 15 83,013,469 (GRCm39) unclassified probably benign
R3755:Poldip3 UTSW 15 83,015,676 (GRCm39) unclassified probably benign
R3756:Poldip3 UTSW 15 83,015,676 (GRCm39) unclassified probably benign
R4785:Poldip3 UTSW 15 83,015,702 (GRCm39) missense probably damaging 1.00
R4917:Poldip3 UTSW 15 83,016,776 (GRCm39) critical splice donor site probably null
R4965:Poldip3 UTSW 15 83,021,706 (GRCm39) missense possibly damaging 0.80
R5009:Poldip3 UTSW 15 83,017,395 (GRCm39) missense probably damaging 1.00
R5030:Poldip3 UTSW 15 83,022,392 (GRCm39) missense possibly damaging 0.67
R5992:Poldip3 UTSW 15 83,013,430 (GRCm39) missense probably damaging 0.96
R6638:Poldip3 UTSW 15 83,017,401 (GRCm39) missense probably damaging 1.00
R9377:Poldip3 UTSW 15 83,019,589 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGGCAATCGGCTTTCCCAAC -3'
(R):5'- GCAGTGCAGTCTTTGGAGAG -3'

Sequencing Primer
(F):5'- TGAGACACACTACTCAGAGAGTGC -3'
(R):5'- TCTTTGGAGAGTGAGCGGCAAG -3'
Posted On 2019-05-13