Incidental Mutation 'R7028:Plg'
ID 546158
Institutional Source Beutler Lab
Gene Symbol Plg
Ensembl Gene ENSMUSG00000059481
Gene Name plasminogen
Synonyms Pg
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.314) question?
Stock # R7028 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 12378609-12419384 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 12391836 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 212 (Q212L)
Ref Sequence ENSEMBL: ENSMUSP00000014578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014578]
AlphaFold P20918
Predicted Effect probably damaging
Transcript: ENSMUST00000014578
AA Change: Q212L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000014578
Gene: ENSMUSG00000059481
AA Change: Q212L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PAN_AP 20 97 8.67e-14 SMART
KR 101 183 1.31e-41 SMART
KR 184 264 5.4e-43 SMART
KR 273 354 3.45e-50 SMART
KR 375 456 3.9e-49 SMART
KR 479 562 5.53e-40 SMART
Tryp_SPc 581 805 4.11e-94 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a secreted blood zymogen that is activated by proteolysis and converted to plasmin and angiostatin. Plasmin dissolves fibrin in blood clots and is an important protease in many other cellular processes while angiostatin inhibits angiogenesis. Defects in this gene are likely a cause of thrombophilia and ligneous conjunctivitis. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous null mutants exhibit retarded growth, variable rectal prolapse, impaired fertility and lactation in females, early mortality, and widespread fibrin deposition and thrombotic lesions in liver, lung, stomach and other tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A G 2: 69,265,675 I804T probably benign Het
Abcb1b A T 5: 8,805,441 E25V probably damaging Het
Adamts9 G T 6: 92,909,793 Y355* probably null Het
Akp3 A G 1: 87,126,778 M303V probably benign Het
Ankrd35 A T 3: 96,683,334 E312V possibly damaging Het
Arhgap40 T C 2: 158,531,374 probably null Het
Asxl1 T C 2: 153,400,107 L859P probably benign Het
Atat1 A G 17: 35,910,005 F11L probably benign Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Ccdc7a A T 8: 128,881,594 H943Q unknown Het
Cep135 A G 5: 76,616,848 T558A probably benign Het
Cfap99 A G 5: 34,301,519 E86G possibly damaging Het
Cfhr2 C T 1: 139,831,063 probably null Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Col17a1 G A 19: 47,652,183 P992L probably damaging Het
Col7a1 C T 9: 108,963,263 Q1294* probably null Het
Coq8b T A 7: 27,239,868 C148S probably damaging Het
Csmd2 A G 4: 128,277,228 N338S Het
Cspg5 T A 9: 110,246,891 S232T possibly damaging Het
Cyp2c67 A G 19: 39,639,897 V201A possibly damaging Het
Dlgap3 G A 4: 127,195,517 R302H possibly damaging Het
Dpy19l2 T C 9: 24,628,251 I469V probably benign Het
Fam135b T C 15: 71,471,563 D401G probably damaging Het
Gabbr1 G T 17: 37,064,737 G453* probably null Het
Gclc C A 9: 77,788,216 A440D probably damaging Het
Glyat T C 19: 12,650,359 I106T probably benign Het
Gm12185 T C 11: 48,908,244 N474S possibly damaging Het
Gm17079 T C 14: 51,693,037 H117R Het
Gm884 C T 11: 103,614,537 A26T probably benign Het
Ildr2 A G 1: 166,303,529 D318G probably damaging Het
Kcnd2 G A 6: 21,216,178 probably benign Het
Kif19a C T 11: 114,781,208 T207M probably damaging Het
Kif3a G T 11: 53,586,906 G401* probably null Het
Lactbl1 T A 4: 136,632,975 L155Q probably damaging Het
Lrp1b T A 2: 41,246,011 D1649V probably benign Het
Map2k1 A G 9: 64,193,823 V191A probably benign Het
Mdm4 A T 1: 133,003,809 C165S probably benign Het
Med27 G A 2: 29,509,434 W92* probably null Het
Muc20 A T 16: 32,794,246 S254T probably benign Het
Myh1 A G 11: 67,220,421 E1562G possibly damaging Het
Nlrp2 C G 7: 5,328,572 R275P possibly damaging Het
Notch2 T A 3: 98,102,387 N543K probably damaging Het
Nup214 T A 2: 32,034,156 S1566T probably benign Het
Nxnl1 T G 8: 71,562,793 E157A possibly damaging Het
Obscn A G 11: 59,079,133 L61P probably damaging Het
Ogg1 A T 6: 113,329,276 I145F probably damaging Het
Olfr1359 A G 13: 21,703,270 K90E possibly damaging Het
Olfr453 G A 6: 42,744,403 R122H probably benign Het
Olfr572 T C 7: 102,927,942 F105L probably damaging Het
Olfr976 T C 9: 39,956,345 T197A probably benign Het
Pclo A G 5: 14,713,447 D3978G unknown Het
Pla2g4e T G 2: 120,170,195 D687A probably damaging Het
Pla2r1 T C 2: 60,458,393 K632E probably damaging Het
Poldip3 A T 15: 83,131,497 N306K probably damaging Het
Pspn A G 17: 56,999,978 L13P possibly damaging Het
Ralgapa1 T C 12: 55,758,059 E484G probably damaging Het
Rbmxl1 G T 8: 78,506,657 T19K probably damaging Het
Rora G A 9: 69,196,083 V31I possibly damaging Het
Skint5 C A 4: 113,940,839 W182C probably damaging Het
Spata31d1c A T 13: 65,036,063 Q473L probably damaging Het
Tesk2 G A 4: 116,802,687 W334* probably null Het
Tmem67 C A 4: 12,075,484 V277L probably benign Het
Trhde A G 10: 114,518,177 M537T probably damaging Het
Ttc30a2 A T 2: 75,976,269 L633* probably null Het
Tubb6 G A 18: 67,401,911 M293I probably benign Het
Ube2ql1 A T 13: 69,738,754 L196Q probably damaging Het
Ubn1 A T 16: 5,055,324 N70I probably damaging Het
Ubtf A T 11: 102,314,980 S40T probably benign Het
Virma C T 4: 11,519,249 A782V possibly damaging Het
Xdh G T 17: 73,943,873 T28K probably damaging Het
Xpo4 A G 14: 57,597,051 S691P probably benign Het
Zfat A C 15: 68,180,452 F491V probably damaging Het
Zfp623 T G 15: 75,948,305 V370G probably damaging Het
Other mutations in Plg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Plg APN 17 12411493 missense probably damaging 1.00
IGL01128:Plg APN 17 12396699 splice site probably benign
IGL01522:Plg APN 17 12404069 missense probably damaging 1.00
IGL01981:Plg APN 17 12403047 splice site probably benign
IGL03338:Plg APN 17 12419072 missense probably damaging 1.00
R0391:Plg UTSW 17 12419081 missense probably damaging 1.00
R0531:Plg UTSW 17 12411447 splice site probably benign
R0646:Plg UTSW 17 12418736 missense probably damaging 1.00
R0759:Plg UTSW 17 12410951 missense probably damaging 1.00
R1013:Plg UTSW 17 12378721 splice site probably benign
R2116:Plg UTSW 17 12384477 missense probably damaging 0.99
R2442:Plg UTSW 17 12410960 missense probably benign 0.15
R2512:Plg UTSW 17 12403229 missense probably benign
R2879:Plg UTSW 17 12404100 missense possibly damaging 0.92
R3107:Plg UTSW 17 12384429 missense probably benign 0.00
R3405:Plg UTSW 17 12403209 missense possibly damaging 0.65
R4409:Plg UTSW 17 12390263 missense probably damaging 1.00
R4861:Plg UTSW 17 12395735 missense probably benign 0.00
R4861:Plg UTSW 17 12395735 missense probably benign 0.00
R4977:Plg UTSW 17 12403089 missense probably damaging 1.00
R4990:Plg UTSW 17 12411510 missense probably benign
R5319:Plg UTSW 17 12403227 missense possibly damaging 0.49
R5443:Plg UTSW 17 12382183 missense probably benign 0.03
R5635:Plg UTSW 17 12395754 missense probably damaging 1.00
R5981:Plg UTSW 17 12378718 critical splice donor site probably null
R6166:Plg UTSW 17 12398114 missense probably damaging 0.99
R6688:Plg UTSW 17 12391845 missense probably damaging 1.00
R6726:Plg UTSW 17 12378708 missense probably damaging 1.00
R6995:Plg UTSW 17 12419051 missense probably benign 0.00
R7168:Plg UTSW 17 12388559 missense probably damaging 1.00
R7356:Plg UTSW 17 12410911 missense probably damaging 1.00
R8902:Plg UTSW 17 12410903 missense probably benign 0.32
R9035:Plg UTSW 17 12390220 nonsense probably null
Z1176:Plg UTSW 17 12414185 missense probably benign 0.02
Z1177:Plg UTSW 17 12403233 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTACTGCCAAGTGGTTACTGG -3'
(R):5'- TTTATATGCAGCCTAGCGGG -3'

Sequencing Primer
(F):5'- AGGAAGCACTGGAGACCTCTC -3'
(R):5'- GAGGATACCCGCCTTGAAAATC -3'
Posted On 2019-05-13