Incidental Mutation 'R7028:Xdh'
ID 546162
Institutional Source Beutler Lab
Gene Symbol Xdh
Ensembl Gene ENSMUSG00000024066
Gene Name xanthine dehydrogenase
Synonyms Xox-1, XO, Xor, Xox1, xanthine oxidase
MMRRC Submission 045129-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.430) question?
Stock # R7028 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 74190890-74257191 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 74250868 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 28 (T28K)
Ref Sequence ENSEMBL: ENSMUSP00000024866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024866]
AlphaFold Q00519
Predicted Effect probably damaging
Transcript: ENSMUST00000024866
AA Change: T28K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000024866
Gene: ENSMUSG00000024066
AA Change: T28K

DomainStartEndE-ValueType
Pfam:Fer2 11 81 5e-12 PFAM
Pfam:Fer2_2 90 163 4.1e-31 PFAM
low complexity region 169 182 N/A INTRINSIC
Pfam:FAD_binding_5 234 414 4.9e-47 PFAM
CO_deh_flav_C 421 525 1.16e-24 SMART
Ald_Xan_dh_C 590 696 1.23e-46 SMART
Pfam:Ald_Xan_dh_C2 704 1239 1e-200 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the xanthine dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein exists as two distinct enzymatic forms, either as xanthine dehydrogenase, or as xanthine oxidase, and functions in purine degradation. Additional studies also suggest a role in adipogenesis, and a function as a structural protein in milk fat droplets in the lactating mammary gland. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele are small and die prematurely while heterozygous females show a lactation defect. Most homozygotes for another null allele die within the first month of renal failure associated with uric acid depletion, renal tubular damage, inflammation, fibrosis and oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A G 2: 69,096,019 (GRCm39) I804T probably benign Het
Abcb1b A T 5: 8,855,441 (GRCm39) E25V probably damaging Het
Adamts9 G T 6: 92,886,774 (GRCm39) Y355* probably null Het
Akp3 A G 1: 87,054,500 (GRCm39) M303V probably benign Het
Ankrd35 A T 3: 96,590,650 (GRCm39) E312V possibly damaging Het
Arhgap40 T C 2: 158,373,294 (GRCm39) probably null Het
Asxl1 T C 2: 153,242,027 (GRCm39) L859P probably benign Het
Atat1 A G 17: 36,220,897 (GRCm39) F11L probably benign Het
Bach1 G A 16: 87,516,179 (GRCm39) R240Q probably benign Het
Ccdc7a A T 8: 129,608,075 (GRCm39) H943Q unknown Het
Cep135 A G 5: 76,764,695 (GRCm39) T558A probably benign Het
Cfap99 A G 5: 34,458,863 (GRCm39) E86G possibly damaging Het
Cfhr2 C T 1: 139,758,801 (GRCm39) probably null Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 105,036,102 (GRCm39) probably benign Het
Col17a1 G A 19: 47,640,622 (GRCm39) P992L probably damaging Het
Col7a1 C T 9: 108,792,331 (GRCm39) Q1294* probably null Het
Coq8b T A 7: 26,939,293 (GRCm39) C148S probably damaging Het
Csmd2 A G 4: 128,171,021 (GRCm39) N338S Het
Cspg5 T A 9: 110,075,959 (GRCm39) S232T possibly damaging Het
Cyp2c67 A G 19: 39,628,341 (GRCm39) V201A possibly damaging Het
Dlgap3 G A 4: 127,089,310 (GRCm39) R302H possibly damaging Het
Dpy19l2 T C 9: 24,539,547 (GRCm39) I469V probably benign Het
Fam135b T C 15: 71,343,412 (GRCm39) D401G probably damaging Het
Gabbr1 G T 17: 37,375,629 (GRCm39) G453* probably null Het
Gclc C A 9: 77,695,498 (GRCm39) A440D probably damaging Het
Glyat T C 19: 12,627,723 (GRCm39) I106T probably benign Het
Gm12185 T C 11: 48,799,071 (GRCm39) N474S possibly damaging Het
Gm17079 T C 14: 51,930,494 (GRCm39) H117R Het
Ift70a2 A T 2: 75,806,613 (GRCm39) L633* probably null Het
Ildr2 A G 1: 166,131,098 (GRCm39) D318G probably damaging Het
Kcnd2 G A 6: 21,216,177 (GRCm39) probably benign Het
Kif19a C T 11: 114,672,034 (GRCm39) T207M probably damaging Het
Kif3a G T 11: 53,477,733 (GRCm39) G401* probably null Het
Lactbl1 T A 4: 136,360,286 (GRCm39) L155Q probably damaging Het
Lrp1b T A 2: 41,136,023 (GRCm39) D1649V probably benign Het
Lrrc37 C T 11: 103,505,363 (GRCm39) A26T probably benign Het
Map2k1 A G 9: 64,101,105 (GRCm39) V191A probably benign Het
Mdm4 A T 1: 132,931,547 (GRCm39) C165S probably benign Het
Med27 G A 2: 29,399,446 (GRCm39) W92* probably null Het
Muc20 A T 16: 32,614,616 (GRCm39) S254T probably benign Het
Myh1 A G 11: 67,111,247 (GRCm39) E1562G possibly damaging Het
Nlrp2 C G 7: 5,331,571 (GRCm39) R275P possibly damaging Het
Notch2 T A 3: 98,009,703 (GRCm39) N543K probably damaging Het
Nup214 T A 2: 31,924,168 (GRCm39) S1566T probably benign Het
Nxnl1 T G 8: 72,015,437 (GRCm39) E157A possibly damaging Het
Obscn A G 11: 58,969,959 (GRCm39) L61P probably damaging Het
Ogg1 A T 6: 113,306,237 (GRCm39) I145F probably damaging Het
Or10d5j T C 9: 39,867,641 (GRCm39) T197A probably benign Het
Or2b2 A G 13: 21,887,440 (GRCm39) K90E possibly damaging Het
Or2f1 G A 6: 42,721,337 (GRCm39) R122H probably benign Het
Or51h5 T C 7: 102,577,149 (GRCm39) F105L probably damaging Het
Pclo A G 5: 14,763,461 (GRCm39) D3978G unknown Het
Pla2g4e T G 2: 120,000,676 (GRCm39) D687A probably damaging Het
Pla2r1 T C 2: 60,288,737 (GRCm39) K632E probably damaging Het
Plg A T 17: 12,610,723 (GRCm39) Q212L probably damaging Het
Poldip3 A T 15: 83,015,698 (GRCm39) N306K probably damaging Het
Pspn A G 17: 57,306,978 (GRCm39) L13P possibly damaging Het
Ralgapa1 T C 12: 55,804,844 (GRCm39) E484G probably damaging Het
Rbmxl1 G T 8: 79,233,286 (GRCm39) T19K probably damaging Het
Rora G A 9: 69,103,365 (GRCm39) V31I possibly damaging Het
Skint5 C A 4: 113,798,036 (GRCm39) W182C probably damaging Het
Spata31d1c A T 13: 65,183,877 (GRCm39) Q473L probably damaging Het
Tesk2 G A 4: 116,659,884 (GRCm39) W334* probably null Het
Tmem67 C A 4: 12,075,484 (GRCm39) V277L probably benign Het
Trhde A G 10: 114,354,082 (GRCm39) M537T probably damaging Het
Tubb6 G A 18: 67,534,981 (GRCm39) M293I probably benign Het
Ube2ql1 A T 13: 69,886,873 (GRCm39) L196Q probably damaging Het
Ubn1 A T 16: 4,873,188 (GRCm39) N70I probably damaging Het
Ubtf A T 11: 102,205,806 (GRCm39) S40T probably benign Het
Virma C T 4: 11,519,249 (GRCm39) A782V possibly damaging Het
Xpo4 A G 14: 57,834,508 (GRCm39) S691P probably benign Het
Zfat A C 15: 68,052,301 (GRCm39) F491V probably damaging Het
Zfp623 T G 15: 75,820,154 (GRCm39) V370G probably damaging Het
Other mutations in Xdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Xdh APN 17 74,230,101 (GRCm39) missense possibly damaging 0.58
IGL00556:Xdh APN 17 74,191,430 (GRCm39) makesense probably null
IGL01524:Xdh APN 17 74,230,132 (GRCm39) critical splice acceptor site probably null
IGL01604:Xdh APN 17 74,216,332 (GRCm39) missense probably benign 0.02
IGL01625:Xdh APN 17 74,223,781 (GRCm39) critical splice donor site probably null
IGL01778:Xdh APN 17 74,207,275 (GRCm39) missense probably benign 0.00
IGL01804:Xdh APN 17 74,199,754 (GRCm39) missense probably damaging 1.00
IGL01825:Xdh APN 17 74,198,240 (GRCm39) missense probably damaging 1.00
IGL01929:Xdh APN 17 74,241,850 (GRCm39) missense probably damaging 1.00
IGL02068:Xdh APN 17 74,220,945 (GRCm39) missense probably damaging 1.00
IGL02079:Xdh APN 17 74,198,272 (GRCm39) missense probably damaging 1.00
IGL02210:Xdh APN 17 74,250,890 (GRCm39) missense probably benign 0.00
IGL02261:Xdh APN 17 74,220,960 (GRCm39) missense possibly damaging 0.81
IGL02365:Xdh APN 17 74,250,885 (GRCm39) missense probably benign 0.14
IGL02424:Xdh APN 17 74,233,565 (GRCm39) missense probably benign 0.00
IGL02491:Xdh APN 17 74,193,459 (GRCm39) missense probably damaging 0.99
IGL02525:Xdh APN 17 74,231,990 (GRCm39) missense possibly damaging 0.91
IGL02578:Xdh APN 17 74,213,241 (GRCm39) missense probably damaging 1.00
IGL02793:Xdh APN 17 74,207,576 (GRCm39) missense probably damaging 1.00
IGL02939:Xdh APN 17 74,250,840 (GRCm39) critical splice donor site probably null
IGL03327:Xdh APN 17 74,223,787 (GRCm39) missense probably benign
IGL03345:Xdh APN 17 74,213,027 (GRCm39) missense probably damaging 0.98
IGL03353:Xdh APN 17 74,202,781 (GRCm39) missense possibly damaging 0.65
inky UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
nucleus UTSW 17 74,206,007 (GRCm39) nonsense probably null
squidgame UTSW 17 74,246,831 (GRCm39) missense probably benign
R0018:Xdh UTSW 17 74,232,020 (GRCm39) missense probably benign 0.00
R0018:Xdh UTSW 17 74,232,020 (GRCm39) missense probably benign 0.00
R0033:Xdh UTSW 17 74,214,627 (GRCm39) missense probably benign 0.06
R0079:Xdh UTSW 17 74,198,213 (GRCm39) missense probably damaging 1.00
R0086:Xdh UTSW 17 74,191,433 (GRCm39) missense probably benign
R0319:Xdh UTSW 17 74,213,096 (GRCm39) splice site probably benign
R0336:Xdh UTSW 17 74,229,458 (GRCm39) missense possibly damaging 0.91
R0389:Xdh UTSW 17 74,205,357 (GRCm39) missense probably damaging 1.00
R0684:Xdh UTSW 17 74,250,886 (GRCm39) missense probably damaging 0.97
R0930:Xdh UTSW 17 74,230,077 (GRCm39) missense probably benign 0.00
R1073:Xdh UTSW 17 74,246,831 (GRCm39) missense probably benign
R1114:Xdh UTSW 17 74,248,144 (GRCm39) splice site probably benign
R1201:Xdh UTSW 17 74,225,413 (GRCm39) missense probably benign 0.05
R1230:Xdh UTSW 17 74,198,251 (GRCm39) missense probably damaging 1.00
R1351:Xdh UTSW 17 74,230,073 (GRCm39) missense probably benign 0.02
R1470:Xdh UTSW 17 74,198,107 (GRCm39) missense probably damaging 1.00
R1470:Xdh UTSW 17 74,198,107 (GRCm39) missense probably damaging 1.00
R1485:Xdh UTSW 17 74,221,014 (GRCm39) nonsense probably null
R1548:Xdh UTSW 17 74,220,896 (GRCm39) missense probably damaging 0.98
R1637:Xdh UTSW 17 74,207,573 (GRCm39) missense probably benign
R1641:Xdh UTSW 17 74,233,547 (GRCm39) missense probably benign
R1758:Xdh UTSW 17 74,217,204 (GRCm39) missense probably damaging 1.00
R1951:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R1969:Xdh UTSW 17 74,199,746 (GRCm39) missense possibly damaging 0.55
R2024:Xdh UTSW 17 74,228,300 (GRCm39) missense possibly damaging 0.92
R2080:Xdh UTSW 17 74,216,320 (GRCm39) missense probably damaging 1.00
R2157:Xdh UTSW 17 74,229,532 (GRCm39) missense probably damaging 1.00
R2300:Xdh UTSW 17 74,198,260 (GRCm39) missense probably damaging 1.00
R3783:Xdh UTSW 17 74,200,590 (GRCm39) splice site probably benign
R3796:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3797:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3798:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3799:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3819:Xdh UTSW 17 74,213,720 (GRCm39) missense probably benign 0.35
R4085:Xdh UTSW 17 74,223,874 (GRCm39) missense probably benign 0.35
R4240:Xdh UTSW 17 74,202,790 (GRCm39) missense possibly damaging 0.72
R4356:Xdh UTSW 17 74,222,685 (GRCm39) missense probably benign 0.01
R4522:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4523:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4524:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4600:Xdh UTSW 17 74,217,195 (GRCm39) missense probably benign 0.19
R4617:Xdh UTSW 17 74,225,389 (GRCm39) missense probably damaging 0.99
R4756:Xdh UTSW 17 74,193,381 (GRCm39) missense probably benign 0.24
R4761:Xdh UTSW 17 74,217,262 (GRCm39) missense possibly damaging 0.91
R4815:Xdh UTSW 17 74,213,210 (GRCm39) missense probably damaging 1.00
R4850:Xdh UTSW 17 74,205,330 (GRCm39) missense probably damaging 1.00
R4896:Xdh UTSW 17 74,217,238 (GRCm39) missense probably damaging 0.96
R4897:Xdh UTSW 17 74,207,703 (GRCm39) missense probably benign
R4923:Xdh UTSW 17 74,231,931 (GRCm39) missense possibly damaging 0.72
R4977:Xdh UTSW 17 74,205,965 (GRCm39) missense probably benign 0.05
R5030:Xdh UTSW 17 74,198,288 (GRCm39) missense probably damaging 1.00
R5185:Xdh UTSW 17 74,232,006 (GRCm39) missense probably damaging 1.00
R5347:Xdh UTSW 17 74,232,027 (GRCm39) missense probably benign
R5556:Xdh UTSW 17 74,204,759 (GRCm39) missense probably benign 0.21
R5566:Xdh UTSW 17 74,200,617 (GRCm39) missense probably damaging 1.00
R5568:Xdh UTSW 17 74,250,880 (GRCm39) missense possibly damaging 0.90
R5635:Xdh UTSW 17 74,220,870 (GRCm39) missense possibly damaging 0.92
R5662:Xdh UTSW 17 74,248,110 (GRCm39) missense probably damaging 0.99
R5955:Xdh UTSW 17 74,205,315 (GRCm39) missense probably damaging 1.00
R6058:Xdh UTSW 17 74,213,264 (GRCm39) missense probably damaging 1.00
R6061:Xdh UTSW 17 74,228,342 (GRCm39) missense probably damaging 1.00
R6412:Xdh UTSW 17 74,242,902 (GRCm39) missense probably benign 0.09
R6526:Xdh UTSW 17 74,207,546 (GRCm39) missense probably damaging 0.97
R6558:Xdh UTSW 17 74,200,708 (GRCm39) missense possibly damaging 0.95
R6843:Xdh UTSW 17 74,230,125 (GRCm39) missense probably damaging 1.00
R6932:Xdh UTSW 17 74,229,557 (GRCm39) missense probably damaging 0.99
R7418:Xdh UTSW 17 74,220,960 (GRCm39) missense possibly damaging 0.81
R7503:Xdh UTSW 17 74,233,205 (GRCm39) missense probably damaging 1.00
R7653:Xdh UTSW 17 74,204,040 (GRCm39) missense probably benign 0.10
R7763:Xdh UTSW 17 74,241,829 (GRCm39) missense possibly damaging 0.69
R7768:Xdh UTSW 17 74,246,831 (GRCm39) missense probably benign
R7904:Xdh UTSW 17 74,229,467 (GRCm39) missense probably benign 0.09
R8010:Xdh UTSW 17 74,216,312 (GRCm39) nonsense probably null
R8067:Xdh UTSW 17 74,207,652 (GRCm39) missense probably benign 0.01
R8238:Xdh UTSW 17 74,193,412 (GRCm39) missense probably benign
R8253:Xdh UTSW 17 74,225,377 (GRCm39) missense possibly damaging 0.94
R8346:Xdh UTSW 17 74,220,938 (GRCm39) missense probably damaging 1.00
R8350:Xdh UTSW 17 74,241,837 (GRCm39) missense probably damaging 1.00
R8381:Xdh UTSW 17 74,219,456 (GRCm39) missense probably benign
R8427:Xdh UTSW 17 74,242,926 (GRCm39) missense probably damaging 1.00
R8465:Xdh UTSW 17 74,206,007 (GRCm39) nonsense probably null
R8478:Xdh UTSW 17 74,213,053 (GRCm39) missense probably benign 0.00
R8680:Xdh UTSW 17 74,229,500 (GRCm39) missense probably benign
R8802:Xdh UTSW 17 74,225,405 (GRCm39) missense probably benign 0.00
R8984:Xdh UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
R8985:Xdh UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
R8995:Xdh UTSW 17 74,205,369 (GRCm39) missense probably damaging 1.00
R9035:Xdh UTSW 17 74,217,222 (GRCm39) missense probably benign
R9149:Xdh UTSW 17 74,222,688 (GRCm39) missense probably benign
R9181:Xdh UTSW 17 74,232,006 (GRCm39) missense probably damaging 1.00
R9357:Xdh UTSW 17 74,233,541 (GRCm39) critical splice donor site probably null
R9357:Xdh UTSW 17 74,214,711 (GRCm39) missense probably damaging 0.97
R9609:Xdh UTSW 17 74,231,990 (GRCm39) missense possibly damaging 0.91
R9803:Xdh UTSW 17 74,229,455 (GRCm39) missense probably benign
X0019:Xdh UTSW 17 74,225,449 (GRCm39) missense probably damaging 1.00
Z1088:Xdh UTSW 17 74,193,423 (GRCm39) missense probably benign
Z1176:Xdh UTSW 17 74,230,037 (GRCm39) critical splice donor site probably null
Z1177:Xdh UTSW 17 74,204,690 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTAGGATCACCCAAGGATTC -3'
(R):5'- AGGTGGAATTCTAGGACCCGAG -3'

Sequencing Primer
(F):5'- CTCAGTTATATTGAGTGCCACAGCTG -3'
(R):5'- AATTCTAGGACCCGAGGGCAC -3'
Posted On 2019-05-13