Incidental Mutation 'R7029:1700034J05Rik'
ID546177
Institutional Source Beutler Lab
Gene Symbol 1700034J05Rik
Ensembl Gene ENSMUSG00000040163
Gene NameRIKEN cDNA 1700034J05 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7029 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location146950329-146954422 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 146952343 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 271 (Q271R)
Ref Sequence ENSEMBL: ENSMUSP00000107249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016631] [ENSMUST00000036592] [ENSMUST00000111622] [ENSMUST00000111623] [ENSMUST00000203730]
Predicted Effect probably benign
Transcript: ENSMUST00000016631
SMART Domains Protein: ENSMUSP00000016631
Gene: ENSMUSG00000016487

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
PDB:3QH9|A 180 256 3e-8 PDB
low complexity region 345 358 N/A INTRINSIC
low complexity region 426 441 N/A INTRINSIC
low complexity region 530 546 N/A INTRINSIC
SAM 603 670 3.06e-13 SMART
SAM 675 741 2.39e-15 SMART
SAM 763 835 7.91e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000036592
AA Change: Q272R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000043802
Gene: ENSMUSG00000040163
AA Change: Q272R

DomainStartEndE-ValueType
Pfam:DUF4640 18 301 2.7e-128 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111622
AA Change: Q271R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000107249
Gene: ENSMUSG00000040163
AA Change: Q271R

DomainStartEndE-ValueType
Pfam:DUF4640 18 300 1.3e-136 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111623
SMART Domains Protein: ENSMUSP00000107250
Gene: ENSMUSG00000016487

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
PDB:3QH9|A 180 256 3e-8 PDB
low complexity region 272 284 N/A INTRINSIC
low complexity region 356 369 N/A INTRINSIC
low complexity region 437 452 N/A INTRINSIC
low complexity region 541 557 N/A INTRINSIC
SAM 614 681 3.06e-13 SMART
SAM 686 752 2.39e-15 SMART
SAM 774 846 7.91e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203730
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd4 T A 14: 54,262,707 W63R probably damaging Het
Adcy5 A G 16: 35,299,648 M1176V probably null Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Brox G A 1: 183,284,186 P206L possibly damaging Het
Def6 A G 17: 28,225,969 K447R probably benign Het
Dna2 T C 10: 62,963,994 S726P probably damaging Het
Ell G A 8: 70,579,229 V15I probably damaging Het
Epha3 T A 16: 63,773,335 D130V probably benign Het
Fam189a1 T A 7: 64,759,327 T440S probably benign Het
Gm16486 G T 8: 70,708,862 V235L possibly damaging Het
Gys1 A G 7: 45,439,584 T200A possibly damaging Het
Habp4 A T 13: 64,162,125 H47L probably benign Het
Kcnj10 C A 1: 172,368,996 R26S probably benign Het
Klhl1 T A 14: 96,518,196 D41V probably benign Het
Lyn A G 4: 3,782,996 T410A probably damaging Het
Mga A G 2: 119,923,550 T847A probably damaging Het
Mrgpra3 G T 7: 47,589,542 T212N probably benign Het
Myh4 T C 11: 67,246,425 F491L probably benign Het
Neurl4 T A 11: 69,910,736 I1206N probably damaging Het
Nov A G 15: 54,747,775 D102G possibly damaging Het
Pcdhb15 T A 18: 37,475,568 W618R possibly damaging Het
Pomc A G 12: 3,960,146 H129R probably damaging Het
Ppm1l C A 3: 69,553,066 H325Q probably benign Het
Psme4 A G 11: 30,772,474 probably benign Het
Reep2 A G 18: 34,845,289 I74V probably null Het
Robo2 T G 16: 73,948,337 E850A probably damaging Het
Scrn2 T A 11: 97,030,436 probably benign Het
Sfpq G A 4: 127,029,882 R673K probably benign Het
Sh2d3c T C 2: 32,754,569 *703R probably null Het
Spp1 A G 5: 104,439,301 M85V probably benign Het
Srebf1 T C 11: 60,206,984 E98G probably damaging Het
Srrm4 T A 5: 116,444,792 probably benign Het
Ticam1 A T 17: 56,271,154 S314T possibly damaging Het
Tie1 T C 4: 118,484,626 I209V possibly damaging Het
Vapa G A 17: 65,582,591 R194* probably null Het
Vcan C T 13: 89,690,241 D2395N probably damaging Het
Whamm A G 7: 81,591,826 H295R probably benign Het
Zdhhc14 A G 17: 5,647,911 Y85C probably damaging Het
Zfp35 T A 18: 24,003,526 F309Y probably damaging Het
Zfp423 C A 8: 87,688,066 C1187F probably damaging Het
Zfp874b T C 13: 67,474,273 Y302C probably damaging Het
Other mutations in 1700034J05Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01654:1700034J05Rik APN 6 146953340 missense probably damaging 1.00
IGL01725:1700034J05Rik APN 6 146952269 missense probably damaging 0.97
IGL01860:1700034J05Rik APN 6 146952416 missense possibly damaging 0.77
IGL01991:1700034J05Rik APN 6 146953110 missense probably benign 0.32
IGL02375:1700034J05Rik APN 6 146953315 missense possibly damaging 0.92
R0254:1700034J05Rik UTSW 6 146952404 missense probably benign 0.00
R0361:1700034J05Rik UTSW 6 146952371 missense possibly damaging 0.94
R0835:1700034J05Rik UTSW 6 146953538 intron probably benign
R1101:1700034J05Rik UTSW 6 146952411 missense possibly damaging 0.95
R1428:1700034J05Rik UTSW 6 146952411 missense possibly damaging 0.95
R1487:1700034J05Rik UTSW 6 146953379 missense probably benign 0.16
R1887:1700034J05Rik UTSW 6 146952411 missense possibly damaging 0.95
R1988:1700034J05Rik UTSW 6 146952896 missense possibly damaging 0.70
R1989:1700034J05Rik UTSW 6 146952896 missense possibly damaging 0.70
R4063:1700034J05Rik UTSW 6 146953108 missense probably benign 0.32
R6122:1700034J05Rik UTSW 6 146952252 makesense probably null
R6578:1700034J05Rik UTSW 6 146953314 nonsense probably null
R7585:1700034J05Rik UTSW 6 146953353 missense probably benign 0.00
R7842:1700034J05Rik UTSW 6 146953536 missense unknown
R7925:1700034J05Rik UTSW 6 146953536 missense unknown
X0066:1700034J05Rik UTSW 6 146953540 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- GGAAACTCCCACTGTGTACTC -3'
(R):5'- TCCTGTTTTCTCAGCAGGAG -3'

Sequencing Primer
(F):5'- CCACTGTGTACTCCAGGTATTG -3'
(R):5'- GATAAGACAGGCATCTGAGAGCTCC -3'
Posted On2019-05-13