Incidental Mutation 'R7029:Mrgpra3'
ID546179
Institutional Source Beutler Lab
Gene Symbol Mrgpra3
Ensembl Gene ENSMUSG00000078698
Gene NameMAS-related GPR, member A3
SynonymsG protein-coupled receptor, MrgA3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.046) question?
Stock #R7029 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location47588950-47601372 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 47589542 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 212 (T212N)
Ref Sequence ENSEMBL: ENSMUSP00000135437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000176369]
Predicted Effect probably benign
Transcript: ENSMUST00000176369
AA Change: T212N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000135437
Gene: ENSMUSG00000078698
AA Change: T212N

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 48 234 6.3e-7 PFAM
Pfam:7tm_1 57 286 2.7e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,343 Q271R probably benign Het
Abhd4 T A 14: 54,262,707 W63R probably damaging Het
Adcy5 A G 16: 35,299,648 M1176V probably null Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Brox G A 1: 183,284,186 P206L possibly damaging Het
Def6 A G 17: 28,225,969 K447R probably benign Het
Dna2 T C 10: 62,963,994 S726P probably damaging Het
Ell G A 8: 70,579,229 V15I probably damaging Het
Epha3 T A 16: 63,773,335 D130V probably benign Het
Fam189a1 T A 7: 64,759,327 T440S probably benign Het
Gm16486 G T 8: 70,708,862 V235L possibly damaging Het
Gys1 A G 7: 45,439,584 T200A possibly damaging Het
Habp4 A T 13: 64,162,125 H47L probably benign Het
Kcnj10 C A 1: 172,368,996 R26S probably benign Het
Klhl1 T A 14: 96,518,196 D41V probably benign Het
Lyn A G 4: 3,782,996 T410A probably damaging Het
Mga A G 2: 119,923,550 T847A probably damaging Het
Myh4 T C 11: 67,246,425 F491L probably benign Het
Neurl4 T A 11: 69,910,736 I1206N probably damaging Het
Nov A G 15: 54,747,775 D102G possibly damaging Het
Pcdhb15 T A 18: 37,475,568 W618R possibly damaging Het
Pomc A G 12: 3,960,146 H129R probably damaging Het
Ppm1l C A 3: 69,553,066 H325Q probably benign Het
Psme4 A G 11: 30,772,474 probably benign Het
Reep2 A G 18: 34,845,289 I74V probably null Het
Robo2 T G 16: 73,948,337 E850A probably damaging Het
Scrn2 T A 11: 97,030,436 probably benign Het
Sfpq G A 4: 127,029,882 R673K probably benign Het
Sh2d3c T C 2: 32,754,569 *703R probably null Het
Spp1 A G 5: 104,439,301 M85V probably benign Het
Srebf1 T C 11: 60,206,984 E98G probably damaging Het
Srrm4 T A 5: 116,444,792 probably benign Het
Ticam1 A T 17: 56,271,154 S314T possibly damaging Het
Tie1 T C 4: 118,484,626 I209V possibly damaging Het
Vapa G A 17: 65,582,591 R194* probably null Het
Vcan C T 13: 89,690,241 D2395N probably damaging Het
Whamm A G 7: 81,591,826 H295R probably benign Het
Zdhhc14 A G 17: 5,647,911 Y85C probably damaging Het
Zfp35 T A 18: 24,003,526 F309Y probably damaging Het
Zfp423 C A 8: 87,688,066 C1187F probably damaging Het
Zfp874b T C 13: 67,474,273 Y302C probably damaging Het
Other mutations in Mrgpra3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Mrgpra3 APN 7 47589519 missense probably benign 0.00
IGL02097:Mrgpra3 APN 7 47589456 missense possibly damaging 0.94
IGL02101:Mrgpra3 APN 7 47589552 missense probably damaging 0.99
IGL03071:Mrgpra3 APN 7 47589181 utr 3 prime probably benign
PIT4445001:Mrgpra3 UTSW 7 47590160 missense possibly damaging 0.88
R0828:Mrgpra3 UTSW 7 47590136 missense probably benign 0.12
R1118:Mrgpra3 UTSW 7 47589291 missense possibly damaging 0.83
R1835:Mrgpra3 UTSW 7 47589946 nonsense probably null
R2258:Mrgpra3 UTSW 7 47590094 missense probably benign 0.35
R2393:Mrgpra3 UTSW 7 47589617 missense possibly damaging 0.92
R3437:Mrgpra3 UTSW 7 47589566 missense probably damaging 1.00
R3973:Mrgpra3 UTSW 7 47589666 missense probably benign 0.22
R4273:Mrgpra3 UTSW 7 47589432 missense probably benign 0.01
R4495:Mrgpra3 UTSW 7 47590065 missense probably benign 0.00
R4768:Mrgpra3 UTSW 7 47589728 missense possibly damaging 0.94
R4822:Mrgpra3 UTSW 7 47589968 missense possibly damaging 0.69
R4967:Mrgpra3 UTSW 7 47589519 missense probably benign 0.33
R5207:Mrgpra3 UTSW 7 47590161 missense probably benign 0.06
R5569:Mrgpra3 UTSW 7 47590011 missense probably benign 0.00
R5763:Mrgpra3 UTSW 7 47589607 nonsense probably null
R6102:Mrgpra3 UTSW 7 47590149 missense possibly damaging 0.92
R6612:Mrgpra3 UTSW 7 47590035 missense probably benign 0.00
R6718:Mrgpra3 UTSW 7 47589696 missense probably benign 0.25
R6859:Mrgpra3 UTSW 7 47590033 missense probably benign 0.04
R7034:Mrgpra3 UTSW 7 47590090 missense possibly damaging 0.49
R7036:Mrgpra3 UTSW 7 47590090 missense possibly damaging 0.49
R7097:Mrgpra3 UTSW 7 47589641 missense probably benign
R7475:Mrgpra3 UTSW 7 47589947 missense probably damaging 1.00
R8289:Mrgpra3 UTSW 7 47589720 missense possibly damaging 0.76
R8315:Mrgpra3 UTSW 7 47601303 start codon destroyed probably null 0.93
Z1177:Mrgpra3 UTSW 7 47601301 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAATGGGGTTGGCACAGCTG -3'
(R):5'- CAGAACACACATCAACTGTCATGTG -3'

Sequencing Primer
(F):5'- CACAGCTGTTAATAGCAGTTAGGACC -3'
(R):5'- ACACATCAACTGTCATGTGTGCTG -3'
Posted On2019-05-13