Incidental Mutation 'R7029:Srebf1'
ID546187
Institutional Source Beutler Lab
Gene Symbol Srebf1
Ensembl Gene ENSMUSG00000020538
Gene Namesterol regulatory element binding transcription factor 1
SynonymsSREBP-1a, SREBP-1c, ADD-1, SREBP1c, SREBP-1, bHLHd1, SREBP1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7029 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location60199089-60222581 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60206984 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 98 (E98G)
Ref Sequence ENSEMBL: ENSMUSP00000120777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020846] [ENSMUST00000144942]
Predicted Effect probably damaging
Transcript: ENSMUST00000020846
AA Change: E122G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000020846
Gene: ENSMUSG00000020538
AA Change: E122G

DomainStartEndE-ValueType
low complexity region 70 85 N/A INTRINSIC
low complexity region 92 105 N/A INTRINSIC
low complexity region 180 198 N/A INTRINSIC
low complexity region 203 217 N/A INTRINSIC
low complexity region 225 235 N/A INTRINSIC
HLH 323 373 6.71e-16 SMART
low complexity region 420 453 N/A INTRINSIC
transmembrane domain 480 502 N/A INTRINSIC
transmembrane domain 533 555 N/A INTRINSIC
low complexity region 589 601 N/A INTRINSIC
low complexity region 650 661 N/A INTRINSIC
low complexity region 679 692 N/A INTRINSIC
low complexity region 1113 1125 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000122934
Gene: ENSMUSG00000020538
AA Change: E68G

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
low complexity region 39 52 N/A INTRINSIC
low complexity region 127 145 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 172 182 N/A INTRINSIC
HLH 265 315 6.71e-16 SMART
low complexity region 362 395 N/A INTRINSIC
transmembrane domain 422 444 N/A INTRINSIC
transmembrane domain 475 497 N/A INTRINSIC
low complexity region 531 543 N/A INTRINSIC
low complexity region 592 603 N/A INTRINSIC
low complexity region 621 634 N/A INTRINSIC
low complexity region 1055 1067 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000144942
AA Change: E98G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120777
Gene: ENSMUSG00000020538
AA Change: E98G

DomainStartEndE-ValueType
low complexity region 46 61 N/A INTRINSIC
low complexity region 68 81 N/A INTRINSIC
low complexity region 156 174 N/A INTRINSIC
low complexity region 179 193 N/A INTRINSIC
low complexity region 201 211 N/A INTRINSIC
HLH 299 349 6.71e-16 SMART
low complexity region 396 429 N/A INTRINSIC
transmembrane domain 456 478 N/A INTRINSIC
transmembrane domain 509 531 N/A INTRINSIC
low complexity region 565 577 N/A INTRINSIC
low complexity region 626 637 N/A INTRINSIC
low complexity region 655 668 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a transcription factor that binds to the sterol regulatory element-1 (SRE1), which is a decamer flanking the low density lipoprotein receptor gene and some genes involved in sterol biosynthesis. The protein is synthesized as a precursor that is attached to the nuclear membrane and endoplasmic reticulum. Following cleavage, the mature protein translocates to the nucleus and activates transcription by binding to the SRE1. Sterols inhibit the cleavage of the precursor, and the mature nuclear form is rapidly catabolized, thereby reducing transcription. The protein is a member of the basic helix-loop-helix-leucine zipper (bHLH-Zip) transcription factor family. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele of transcript A die between E11.5 and E14.5. Mice homozygous for a knock-out allele of transcript C exhibit decreased circulating triglyceride levels. Mice homozygous for a gene trap allele exhibit decreased hepatictriglyceride storage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,343 Q271R probably benign Het
Abhd4 T A 14: 54,262,707 W63R probably damaging Het
Adcy5 A G 16: 35,299,648 M1176V probably null Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Brox G A 1: 183,284,186 P206L possibly damaging Het
Def6 A G 17: 28,225,969 K447R probably benign Het
Dna2 T C 10: 62,963,994 S726P probably damaging Het
Ell G A 8: 70,579,229 V15I probably damaging Het
Epha3 T A 16: 63,773,335 D130V probably benign Het
Fam189a1 T A 7: 64,759,327 T440S probably benign Het
Gm16486 G T 8: 70,708,862 V235L possibly damaging Het
Gys1 A G 7: 45,439,584 T200A possibly damaging Het
Habp4 A T 13: 64,162,125 H47L probably benign Het
Kcnj10 C A 1: 172,368,996 R26S probably benign Het
Klhl1 T A 14: 96,518,196 D41V probably benign Het
Lyn A G 4: 3,782,996 T410A probably damaging Het
Mga A G 2: 119,923,550 T847A probably damaging Het
Mrgpra3 G T 7: 47,589,542 T212N probably benign Het
Myh4 T C 11: 67,246,425 F491L probably benign Het
Neurl4 T A 11: 69,910,736 I1206N probably damaging Het
Nov A G 15: 54,747,775 D102G possibly damaging Het
Pcdhb15 T A 18: 37,475,568 W618R possibly damaging Het
Pomc A G 12: 3,960,146 H129R probably damaging Het
Ppm1l C A 3: 69,553,066 H325Q probably benign Het
Psme4 A G 11: 30,772,474 probably benign Het
Reep2 A G 18: 34,845,289 I74V probably null Het
Robo2 T G 16: 73,948,337 E850A probably damaging Het
Scrn2 T A 11: 97,030,436 probably benign Het
Sfpq G A 4: 127,029,882 R673K probably benign Het
Sh2d3c T C 2: 32,754,569 *703R probably null Het
Spp1 A G 5: 104,439,301 M85V probably benign Het
Srrm4 T A 5: 116,444,792 probably benign Het
Ticam1 A T 17: 56,271,154 S314T possibly damaging Het
Tie1 T C 4: 118,484,626 I209V possibly damaging Het
Vapa G A 17: 65,582,591 R194* probably null Het
Vcan C T 13: 89,690,241 D2395N probably damaging Het
Whamm A G 7: 81,591,826 H295R probably benign Het
Zdhhc14 A G 17: 5,647,911 Y85C probably damaging Het
Zfp35 T A 18: 24,003,526 F309Y probably damaging Het
Zfp423 C A 8: 87,688,066 C1187F probably damaging Het
Zfp874b T C 13: 67,474,273 Y302C probably damaging Het
Other mutations in Srebf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00770:Srebf1 APN 11 60205139 missense probably damaging 0.96
IGL00774:Srebf1 APN 11 60205139 missense probably damaging 0.96
IGL01824:Srebf1 APN 11 60204131 missense probably benign 0.01
IGL02097:Srebf1 APN 11 60202824 missense probably damaging 1.00
IGL02808:Srebf1 APN 11 60201713 critical splice acceptor site probably null
IGL03036:Srebf1 APN 11 60220458 missense possibly damaging 0.85
IGL03055:Srebf1 UTSW 11 60207076 synonymous silent
R0109:Srebf1 UTSW 11 60201804 missense probably benign 0.21
R0109:Srebf1 UTSW 11 60201804 missense probably benign 0.21
R0550:Srebf1 UTSW 11 60201676 missense probably benign 0.00
R0654:Srebf1 UTSW 11 60204116 missense probably benign
R0707:Srebf1 UTSW 11 60204116 missense probably benign
R1466:Srebf1 UTSW 11 60200702 missense probably benign 0.01
R1466:Srebf1 UTSW 11 60200702 missense probably benign 0.01
R1584:Srebf1 UTSW 11 60200702 missense probably benign 0.01
R1899:Srebf1 UTSW 11 60203486 missense probably damaging 1.00
R1900:Srebf1 UTSW 11 60203486 missense probably damaging 1.00
R1905:Srebf1 UTSW 11 60204493 missense probably damaging 1.00
R2172:Srebf1 UTSW 11 60206502 missense probably benign
R2191:Srebf1 UTSW 11 60220539 missense probably damaging 1.00
R2267:Srebf1 UTSW 11 60207147 missense probably damaging 0.99
R2268:Srebf1 UTSW 11 60207147 missense probably damaging 0.99
R5511:Srebf1 UTSW 11 60210358 utr 5 prime probably benign
R5841:Srebf1 UTSW 11 60203584 missense possibly damaging 0.65
R5870:Srebf1 UTSW 11 60203584 missense possibly damaging 0.65
R6003:Srebf1 UTSW 11 60207104 missense possibly damaging 0.82
R6371:Srebf1 UTSW 11 60203515 missense probably damaging 1.00
R6376:Srebf1 UTSW 11 60203535 missense probably null 0.19
R7009:Srebf1 UTSW 11 60200526 missense probably damaging 1.00
R7410:Srebf1 UTSW 11 60205867 missense probably benign 0.03
R7569:Srebf1 UTSW 11 60200121 missense possibly damaging 0.69
R8317:Srebf1 UTSW 11 60200657 missense possibly damaging 0.62
R8370:Srebf1 UTSW 11 60202196 missense probably benign
R8871:Srebf1 UTSW 11 60200769 missense probably benign
RF009:Srebf1 UTSW 11 60204116 missense probably benign
X0017:Srebf1 UTSW 11 60202881 missense probably damaging 0.96
X0025:Srebf1 UTSW 11 60203427 missense probably benign 0.00
Z1176:Srebf1 UTSW 11 60207156 missense possibly damaging 0.95
Z1186:Srebf1 UTSW 11 60206235 missense probably benign 0.03
Z1187:Srebf1 UTSW 11 60206235 missense probably benign 0.03
Z1188:Srebf1 UTSW 11 60206235 missense probably benign 0.03
Z1189:Srebf1 UTSW 11 60206235 missense probably benign 0.03
Z1190:Srebf1 UTSW 11 60206235 missense probably benign 0.03
Z1191:Srebf1 UTSW 11 60206235 missense probably benign 0.03
Z1192:Srebf1 UTSW 11 60206235 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCCTCTGTAAGAGCACAGCG -3'
(R):5'- ACCAAGACAGTGACTTCCCG -3'

Sequencing Primer
(F):5'- GTAAGAGCACAGCGGCCAC -3'
(R):5'- CCTATGCTGGGGGTGAGACAG -3'
Posted On2019-05-13