Incidental Mutation 'R7029:Scrn2'
ID546190
Institutional Source Beutler Lab
Gene Symbol Scrn2
Ensembl Gene ENSMUSG00000020877
Gene Namesecernin 2
SynonymsSES2, D11Moh48
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7029 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location97029938-97033958 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 97030436 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021249] [ENSMUST00000021251] [ENSMUST00000153482]
Predicted Effect unknown
Transcript: ENSMUST00000021249
AA Change: D7E
SMART Domains Protein: ENSMUSP00000021249
Gene: ENSMUSG00000020877
AA Change: D7E

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:Peptidase_C69 83 254 2e-10 PFAM
coiled coil region 362 395 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000021251
SMART Domains Protein: ENSMUSP00000021251
Gene: ENSMUSG00000020878

DomainStartEndE-ValueType
SCOP:d1h6ua2 44 150 1e-15 SMART
Blast:LRR 69 91 7e-6 BLAST
low complexity region 179 191 N/A INTRINSIC
low complexity region 209 225 N/A INTRINSIC
low complexity region 265 292 N/A INTRINSIC
low complexity region 297 323 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000153482
AA Change: D7E
SMART Domains Protein: ENSMUSP00000116606
Gene: ENSMUSG00000020877
AA Change: D7E

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
Pfam:Peptidase_C69 59 181 2.4e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,952,343 Q271R probably benign Het
Abhd4 T A 14: 54,262,707 W63R probably damaging Het
Adcy5 A G 16: 35,299,648 M1176V probably null Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Brox G A 1: 183,284,186 P206L possibly damaging Het
Def6 A G 17: 28,225,969 K447R probably benign Het
Dna2 T C 10: 62,963,994 S726P probably damaging Het
Ell G A 8: 70,579,229 V15I probably damaging Het
Epha3 T A 16: 63,773,335 D130V probably benign Het
Fam189a1 T A 7: 64,759,327 T440S probably benign Het
Gm16486 G T 8: 70,708,862 V235L possibly damaging Het
Gys1 A G 7: 45,439,584 T200A possibly damaging Het
Habp4 A T 13: 64,162,125 H47L probably benign Het
Kcnj10 C A 1: 172,368,996 R26S probably benign Het
Klhl1 T A 14: 96,518,196 D41V probably benign Het
Lyn A G 4: 3,782,996 T410A probably damaging Het
Mga A G 2: 119,923,550 T847A probably damaging Het
Mrgpra3 G T 7: 47,589,542 T212N probably benign Het
Myh4 T C 11: 67,246,425 F491L probably benign Het
Neurl4 T A 11: 69,910,736 I1206N probably damaging Het
Nov A G 15: 54,747,775 D102G possibly damaging Het
Pcdhb15 T A 18: 37,475,568 W618R possibly damaging Het
Pomc A G 12: 3,960,146 H129R probably damaging Het
Ppm1l C A 3: 69,553,066 H325Q probably benign Het
Psme4 A G 11: 30,772,474 probably benign Het
Reep2 A G 18: 34,845,289 I74V probably null Het
Robo2 T G 16: 73,948,337 E850A probably damaging Het
Sfpq G A 4: 127,029,882 R673K probably benign Het
Sh2d3c T C 2: 32,754,569 *703R probably null Het
Spp1 A G 5: 104,439,301 M85V probably benign Het
Srebf1 T C 11: 60,206,984 E98G probably damaging Het
Srrm4 T A 5: 116,444,792 probably benign Het
Ticam1 A T 17: 56,271,154 S314T possibly damaging Het
Tie1 T C 4: 118,484,626 I209V possibly damaging Het
Vapa G A 17: 65,582,591 R194* probably null Het
Vcan C T 13: 89,690,241 D2395N probably damaging Het
Whamm A G 7: 81,591,826 H295R probably benign Het
Zdhhc14 A G 17: 5,647,911 Y85C probably damaging Het
Zfp35 T A 18: 24,003,526 F309Y probably damaging Het
Zfp423 C A 8: 87,688,066 C1187F probably damaging Het
Zfp874b T C 13: 67,474,273 Y302C probably damaging Het
Other mutations in Scrn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Scrn2 APN 11 97030570 missense probably benign 0.03
IGL01580:Scrn2 APN 11 97032130 missense probably benign
R1847:Scrn2 UTSW 11 97032195 missense probably benign 0.22
R2509:Scrn2 UTSW 11 97033166 missense possibly damaging 0.71
R2698:Scrn2 UTSW 11 97032296 unclassified probably benign
R4361:Scrn2 UTSW 11 97032238 missense probably null 1.00
R4927:Scrn2 UTSW 11 97033500 critical splice donor site probably null
R5040:Scrn2 UTSW 11 97030883 missense probably damaging 1.00
R5367:Scrn2 UTSW 11 97033127 missense possibly damaging 0.95
R5534:Scrn2 UTSW 11 97030925 missense probably benign 0.00
R6145:Scrn2 UTSW 11 97032853 missense probably benign 0.35
R7082:Scrn2 UTSW 11 97033082 missense possibly damaging 0.68
R7165:Scrn2 UTSW 11 97033808 missense probably benign
R7468:Scrn2 UTSW 11 97033166 missense possibly damaging 0.95
R7568:Scrn2 UTSW 11 97030886 missense probably damaging 1.00
R7632:Scrn2 UTSW 11 97033142 missense possibly damaging 0.51
R7950:Scrn2 UTSW 11 97030929 missense probably damaging 1.00
R8239:Scrn2 UTSW 11 97032220 missense probably damaging 1.00
R8398:Scrn2 UTSW 11 97030904 missense probably benign 0.07
R8408:Scrn2 UTSW 11 97031043 missense not run
Predicted Primers PCR Primer
(F):5'- GACTCCAAGCCAAGTGCATTG -3'
(R):5'- GAAGGTCTGGGAATAACGTCTC -3'

Sequencing Primer
(F):5'- CTCCAAGCCAAGTGCATTGTTAGTG -3'
(R):5'- TGGGAATAACGTCTCAACCTTC -3'
Posted On2019-05-13